Transcript

pcnx4-201

ID
ZDB-TSCRIPT-090929-18068
Name
pcnx4-201
Previous Names
  • pcnxl4-001
  • zgc:158219-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037667 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037667|OTTDARG00000027843|ZDB-GENE-070209-185 pcnxl4|OTTDARP00000030194 DKEY-15F17.7-001 LG_ BX072537.8 Danio rerio protein_coding KNOWN, 4391 bp
GCATTATTCAACTGCAACATAAGCAGGAGCGACGATGGAT
AACGGGTCCTCTTTATCCCCACACAAACCCTCTACTCGCC
CGACAGCACCTTTCCAGACCTTCTAATTTAGAGTGACGCA
GCGTCAGCGTGGCATGTGTATGTGTTGTGGAGCCTCTGGG
AGGAGATGACTGAGTCTGTTCCTCCTGCGCTGCTGCGTTC
ATCATCATGGGGCCTGATGTGCCCCTGCTCAATGACTACA
AACAGGAGTTCTTTTGGAAGCGCTTTCCTCAGACTGTCCT
GGGGGGACCTAGGCTGAAACTCGGCTACTGTGCCCCGCCA
TATGTCTATGTGCACCAGCTGGTGTTATTCCTGACACCAT
GGCTATTGGGAGGCATCGGGACCCTCCTTTACCAGCTGAG
GGTGCTGGACGAAGCATTTGCGGGCATTGTTTCCGGTGCG
CTCATGCTGGGAGTTGGTGCCATCGTTCAGGGAATGGCAC
GGTGCATGGCACGTAGGACCGGAGTTGTACAAAGACTGCC
TGCTGCCAATAACATCCTGGCAGACGAGGAAGAGGTGGAG
TTTACTCACTGTGTGGCCCCTGAGACAGTACGATTCGTGG
TACCTGGGAAGAGATTTATGGGTAATGTAGTTTTGCACAC
GTGTCTCGCTGGAGCTCTCTGTGGGTTGTCAACATGGTAC
CTGCTGCCGCACAGACTGAGCGGTTTGTATGGGCACACGG
GTGCAGGATTGGGTGCCGTTGTGTCTTTGTTTGCTCTGAG
CTGGGTGACGGTCTGTATTGGGGAGTATTCTCTCATCGTG
AACACGGCTACCGAAACGGCCACATTTCAGCCACAGGACA
CTTATGAGATCACGCCGCTCAACAGGCCCATGTACATACT
TGCCTTCATCGCCGTGGATCTGGCTCTAAGGTTTTCAGAT
TCTGGTGTGGTGGAACTGCAGGTTGCATCTCAGGTTCTTC
ATGTGCTGTTTGTAGTTCTGCCAGTACTCTGGGCTTTGGG
AATGCTCTCTCCGCTGGACGCTCTTCTACTGTGGGCCATG
GAGCAGATCTTGGTGTATGGTCTGGGTGGATCGGCCATGT
CCACCAACATCAGGCTCTTAGTGATGTTTTTGTCATCAGT
GTGTGTTGCAATCTGCACCTACTTCATTCCCACTTCACTC
GGTGTGGTTCTGTTCACCGTGGCCATGGGTTTCCTCTTCA
GCCAGGACCTGACCCAGCTGCTGGTGCTGGTAAAAGGGGT
CTCTCCGACCCTGGGACTGGGCTGGTGGGGGCTTCCTCTT
TCCCTGCTCTTCATAATAGGAGCCTTGACCGAGGCTGGAC
TTCTTCATCAGCTGAACCTTGTCAACTCAGGGAATCTAAC
ATTGAATACGAACTCTGTAGAGAACTGGGAGTCTTCCGGT
GTGGTTCCTCCAAACCCACAGGAGGTGCTTGGCTGGCTTC
TAATTGCTCTGTTTTTCATCACTCGTCTGCTGAGAGAGCT
TCAGGGGGCTTGCATTATTGGAGGAGCCATGCTCAACCCA
CTCTACCCCAAACGGGTCACAACTGCACAGGCTTTCAGGA
GGAAAACCCGTGGCCTGCGTGTTGCAGGAATCATTCGGAG
GATCCTATTGAACCTTGTAAGTCCGTTGACGATGATTGCG
TTCTTGTCCGTGGATGAATCTTTAGGGAAGATACACACAG
CCTCTCTTGCCATTGGCTTCACTCGGGCATTCAGGATGGT
GTGGCAGAGCTCTGAGGCGGCTCTACTGCAGATGGTGTTG
GTGGTGATCATCAAACTTGCAGGGGGACACAGAGTTGCAC
ACTGGCATGACTTGGGCACTACAGTACAGTTAATACTGGT
CTCTCTGGTTGTGAATCGTGTCTCACAGTTTGTATGTAAG
CTGAGTTTTGCTCTTACGGTGTTGATCACATCCTGGACTG
AGAGTAAACAGCGTCGACAGTCAGCAGGAACTCTGCTGGC
ACTCAATGCTGCTTTGTGCCCACTTCTACTGGCCGTCGTG
GCTCTATCTGCTCTTCTCTCTGCCCCTCTCCTTCCACTAT
TCACACTACCGGTGTTCCTGGTGGGATTTCCCAGGCCGCT
GCGCTCATGGCCAGGCACTCCTGGCACCGCCTGCCCTTGC
CCAGATTCTGTGTATTACCAGCAGCTCTGCAAAAGGCTGG
CATCAGCTATAAGACCTGCACTTGCTAATGGTGCATTTGG
ATCCTGCACTCCAGGGTCTCATTACCTAGGCCGCTTTCAG
GGTCGTCTTCTGTGGATCTCGATTCTAGAAAAGGGCTATG
GCTATTGCACAGTCAACATTAAGGGTCTGGAACTACAGGA
GACATCATGCCACACAGTGGAAGCTCGGCGTGTGGACGAG
GTTTTCGAAGGAGCGTTTGATCACGTGGAGCGGCCAGGCC
AGTGTTTCAGACTATTGAACCCTAACTGGGGTAACGCTCT
TATCCCCTGCTCTCTGTTGCCCGTCAGGGTTTACTCTGAT
GCCCAGAGCGTTCTAACGGGAATTATTGACTCACCCGATC
ACCTGCGTCAGCTAAACTCTGACTTCCTCAAAACACTTGT
CTGGATTCTATTGCGTTACTGTGTACAGGAATTCACATGC
GGTGCTCAGCGAACTAAAGGTCAGACTTTACAGACCTCTG
GACGTAAGTCACAAAGCTCCCAGCATCCTGTGCCCTCAGA
GGCAGGTCCAGCTGTGATCAAAGTGGAGACTCAAGTACGC
CCTGAATCCTCCTCGTCCTCTCACTTGAGGGGTCTGGACA
GCTCCAGCCTGTCGTCCTTTGCTGATTGGTCAGACGAGGA
TGATCTGTTTGGTCCAGTCCCTGTGCGACGACCGATGAGA
ATGATGGTGCGGACAGATGAAGCGCAGACAGAGTTAGGGC
TGGGTGTGTCTCTTCCAGGTTCTGTCGAAATCCACAGCTT
GTATGAGAGCATGGCTCTGTCTTCTCTACCGACCCTTAGA
CCTCTGGGTCTGGGTTTGGGACTTGGCCTGCCCATTATAG
ATAAAGGGAAAGAAAACATCCCTGCACCTACTTCGACAAC
TGTCCGGACCAACTCCCAGCCTCTTCTCTTTACCAGCCCT
CACTCAGAGCTCTTCTCTCTGCCCGCAGACTGGCGAACCG
CCAACTTGGCTTCCTCTAAACTCCAGGTTTTGCGACCCTG
CTTCCCAGAGGCCTGGTTCTGCTTCTGTTTATCCCAGCTG
GTGCTAGAGAGTTTGGGAGAAGGAGACTTTGAGCAGGTGA
CGCAGGGTTTACAGGAGGACCGTGCCTTGCAAGAGCTTTA
TACCCAGGTGGTGCTATCATGCTGTGTGGCGCTAGGGGCA
GATGCTCAGGTCTTCAGCCCAAATCTGCTGTTCAGGCTGT
ACTGTGGGGACGGCCCCTGGACTGAGGGGCTTGAGTGGCT
CCGAGCCAATAAAGAGCTGCATCAGCTCACACTCAGAGCT
TTCAGGTACAGCGTAAAACTATTGGTAGACCAGGCATCTC
TTGGTCCAGTAGAGAGTCTGGATGAGCTCTACACTACTTT
GCAGGATTACCATAAAAACTGGTTCATCGGCCTGGTATCA
GATCGCAGTTGGCAAGATAGTGTTGTACAGGAGAAGCCCT
TCCTGTTCTCTCTTGGACATGACCTCACCATGGGGACGTA
CACCAGCCGTGTGTTGTCCCTGCAGGAGAATCTGGTCCAA
GTGGGAGCTCTAAATGAGGAGGGGGTGAGGGGCCAGTGGG
CCAACCTGTCATGGGAACTATTGTATGCCACTAATGACGA
TGAGGAGCGCTACAGCATTCAGGCCCATCCAGTGATGCTG
AGGAACCTCACTATTCAAGCAGCAGATCCGCCTCTGGGAT
ATCCCATATACTCATCCCCTCCAATTCACCTCCGCTGCTT
GTGATGCTACCAGCTAACCCATTTCACACAGTCACATGGT
TGTGCATTCAATTAGCTCTTTGTGTTTAGGGTACAGAAAT
ACATTTTTAAAGGAAAAAGCATTTACAAAGGCTACAATGG
TAGCAACATCTGGCTTCTGAAAGAAATGCATGAATATCTG
AACATCAGCAGATCCCAGATTTATTGGACCTCTAGATGAA
TCTTGACTGACTTTGAATTCACACTGAGCTTCCTTTCCAC
ATTTTTATTTAAAATTTTATTTCCTCGTCGTGTCAGGCAG
GAAATATGTTGCCAATTTAAAGAGCCTGTTTGTCAAATCT
CAAGGACGTGCCTTGTTTACTACTTTTAGTGGTTATGAAC
AGTTTTAGGTGACCACCTTGTGTTATAAATATCAACTGGC
TCTTCCTCCTTTGTTCATCCTATTTGGACTCTTGTCATTG
TATGGTTGTGTAATTGTTTGTACAGAAGAAATACAGACGT
TTCGTATAAAAACAGTACATTTTAATACTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations