ZFIN ID: ZDB-TSCRIPT-090929-18052
Transcript Name: rufy2-202
Previous Name: rufy2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037651 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037651|OTTDARG00000027831|ZDB-GENE-070424-66 rufy2|OTTDARP00000030179 rufy2-001 LG_ BX530068.35 Danio rerio protein_coding KNOWN, 2692 bp
GCTCCACTAACAGACATTGGTCAGATCTCTACACCCAGAA
GTACCAGAACAACACCAGCACAGGGTGTGGGTTTAACTGG
GGGTTCATTCATTTAGACCCTGAAGGGGGTTTTGGAGTGG
CAGTCATGTATTCCCCTCAGAGTCTTCACCGATGGGGCAT
CACACATAGTGAAAGTATGGAGCGTTTGGCCTACAGTCAA
GCCTTTCGGGATCCCATGGCAATGGAGCGAGCTAACTTGC
TCAATATGGCTAAGCTTAGCATCAAAGGCCTGATCGAGTC
AGCTCTGAGCTTCGGACGAACTCTGGACTCTGACTATCCG
CCTCTGCAACAGTTCTTTGTTGTCATGGAGCACTGCCTGA
AACATGGCCTCAAGGTGAAGAAATCGTTTCTTGGTTACAA
CAAGTCATTGTGGGGGCCTCTGGAGATGGTGGAGAAGCTT
TGCCCAGAAGCAGGAGAAATCGCAGCCAGTGTACGAGATC
TTCCTGGCCTGAAGACTCCTCTGGGCAGAGCCAGAGCGTG
GTTGAGACTGGCACTGATGCAGAAGAAATTAGCTGATTAC
CTTCGCCTCCTCATCACCAGGAAAGACATTCTTAGTGAGT
TTTATGAGAGCTCAGCGGTGATGCTGGAGGAGGAAGGCGC
TGTCATTGTTGGGCTCCTGGTGGGACTGAACGTCATTGAT
GCAAACTTGTGTGTGAAGGGTGAAGACCTCGATACGCAAG
TTGGTGTAATAGACTTCTCCATGTACTTGAAGAATGACAT
TGATGACTACAGAAGTGAAGAAAGGAATGGACAGATTGCA
GCTATTTTGGATCAGAAGAACTATGTTGAAGAATTAAATA
GGCAGCTGAATTCTACAGTGCAAGGCCTGCAGGGGCGCGT
GGAGTCATTAGAAAAAACCAACTCCAAACTCATAGAAGAG
TTGGCAATAGCGAAAAACAACATAATCAAGCTGCAGGAAG
AAAACCACCAACTCAGAACCGAAAATTCTGTCATTCTAAT
GAAAGCACAACAACGTCTTGCGGTTACAGAAGGAGATTTG
AGCTGTGAGTTGGACACGTACAAGCAGTCAAGGCAGGGCC
TGGATGAAATGTACAACGAGGCTAGACGCCAACTAAAAGA
GGAATGTCAGCTCCGGCAGGATGTGGAGAATGAGCTGGTT
GTGCAGGTGAGCATGAAGCAGGAGATGGAGATGGCCATGA
AACTGCTAGAAAAGGACATCCATGAAAAACAGGACACTCT
GATTGGACTCCGGCACCAGTTAGATGAAGTAAAAGCCATC
AATGTGGAGATGTACCAAAAAATGCAGTCTTCAGACGACA
GCATGAGACAGAAGAATGACATGATCGCACGGTTGGAGGA
GAAGACCAATCAAATTACGGCAACTATGAAACAACTAGAG
CAAAGATTGCAGGATGCCGAGAGGGAACGGGCCAGTGCCG
AAGACGGGGTGCGCAAATTCAAGCAGGACTTCACAAACAA
AGCCGAAAGTCTCCAAAAGCAGATAGTCCAGAGAGAGAAG
CAGATGACGCAGCTGGAAACAGACTTGAAAATCGAGAGGG
ATTGGCGGCAGACGTTACAGAATGAACTGGAGAGAGAACG
AGAGACAATCACCCAACTAGCTGCTGAAGCTCAGCAAATC
AACGGACTCAAAAAAGAGTTTCACAGGCTGCAGGATGAGA
ACACACTGCTGAAGGGGATTTGTGAAGAGCAGGAACATGC
GCTGGAGGAACTGGGCTGCAAATTAAGCGAGTCAAAGTTG
AAAATCGAAGATATAAAAGAAGCCAACAAGGCACTTCAGG
GTGGACAGGTCTGGCTGAAGGACAAAGACGCTACACATTG
CAAGCTTTGCGAGAAGGAATTTTCAATCTCCAGAAGAAAG
CACCACTGCAGGAACTGTGGCGAGATCTTCTGTAACGCCT
GTTCAGATAATGAGCTGCCGCTTCCCGCTTCTCCCAAACC
CGTGAGAGTCTGCGACACATGCCACGCTATGCTCCTCCAG
CGCTGCTCCTCCAACACCACATAAAACACGACGCTAACAA
GTCCCAAAGTGGCCAAAATGGAGTTTACATTTCAGATGGG
GGGAAAAAAAGCTTGTTGCTTCCGGTGCAGATGGCCAATG
CGATGTTCGTCAGCGAGCGCGCAACGAGTTTACAAATGGA
TTAATGACTCTTAACGCCTCCGTCTGGGGTGCAAGTCGAC
CGATTTCAGGTTTTATATTAGCACAACACTCCCATGCATT
TTTGATATATGAAGGGTGAACCGGTTTCATTCCTTGTCAG
TCAGAAGTCAATTCAGTTACTCGTTTCTTAAGCAACTGTA
TTTCTGATTCAGTTCATTCATGTGTGCCTGCATAACAAGC
CAAACTGACAAGAGATTTGACATCATTCCAGATGTTTGTA
TATGTACGGCAGAAGAGAAAATGTTGTCAGTGCTGCTCAT
GAATGATTGAGGTTGATTCTCGTCAAATAGCACAGAAACG
TTGTTGTGAATACGATGTTCAGGTTTCTTGTCTGCAGTAT
GGTATTATTTCACAACTGCAGATTTACTTTGGTACAGAAC
TGGAACACTACTCACTTTGAGCATTTGTGTTGACTTTTGT
CTGAATAATTGTTCATAATGCAGCTGTTAACTTAAATGTG
AAGTTTATGAAACTGTACATATGCCTTACACAACTAAAGT
TGACTATAATTC

rufy2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rufy2-201 (1) 2902
rufy2-202 2692
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rufy2-202 Contained in:
OTHER rufy2-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037651 (1)
  • Ensembl_Trans:ENSDART00000143097 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC134954 (1) 2674bp
    GenBank:CK696715 (1) 548bp
    CITATIONS (2)