ZFIN ID: ZDB-TSCRIPT-090929-18053
Transcript Name: rufy2-201
Previous Name: rufy2-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037652 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037652|OTTDARG00000027831|ZDB-GENE-070424-66 rufy2|OTTDARP00000030180 rufy2-002 LG_ BX530068.35 Danio rerio protein_coding KNOWN, 2902 bp
GGGGCGTTGACAAGAAGCATCACAAGGGAAAGCGCTCGAG
CTGCAGCCGTCCAGCGTTTATCAATGCCGCTCAACACATC
ACCGCCCTGGCTGTTAGGTGAAGCGTTACCCTAAACAGTG
TGAGATTCACTTTCACGATGGCGACACCTGCAGAACAGGA
CCTTGTGTTGGCGGAAGCAGAGGGCAACAAAGAGAGAACG
CAAGTGTTCGGGATCCTCAGATTGCAGGAGGATAAATCGG
CCGGCGAGAAAGCGAGCAGCCCTGCCATGAAATCTGGAGA
CGGGAGATGGCAGGCGCCCATATTCGCGCTAGCCAGAAAG
GCTTCAGAAACCTTCTCTGGTGGCATTCATGTGCTTCCCA
AAGTTACAGAGCCTAAAACGTCGCCTTTTACCGAAGAATG
GGGTGCCAGGGCCTTTCGGGATCCCATGGCAATGGAGCGA
GCTAACTTGCTCAATATGGCTAAGCTTAGCATCAAAGGCC
TGATCGAGTCAGCTCTGAGCTTCGGACGAACTCTGGACTC
TGACTATCCGCCTCTGCAACAGTTCTTTGTTGTCATGGAG
CACTGCCTGAAACATGGCCTCAAGGTGAAGAAATCGTTTC
TTGGTTACAACAAGTCATTGTGGGGGCCTCTGGAGATGGT
GGAGAAGCTTTGCCCAGAAGCAGGAGAAATCGCAGCCAGT
GTACGAGATCTTCCTGGCCTGAAGACTCCTCTGGGCAGAG
CCAGAGCGTGGTTGAGACTGGCACTGATGCAGAAGAAATT
AGCTGATTACCTTCGCCTCCTCATCACCAGGAAAGACATT
CTTAGTGAGTTTTATGAGAGCTCAGCGGTGATGCTGGAGG
AGGAAGGCGCTGTCATTGTTGGGCTCCTGGTGGGACTGAA
CGTCATTGATGCAAACTTGTGTGTGAAGGGTGAAGACCTC
GATACGCAAGTTGGTGTAATAGACTTCTCCATGTACTTGA
AGAATGACATTGATGACTACAGAAGTGAAGAAAGGAATGG
ACAGATTGCAGCTATTTTGGATCAGAAGAACTATGTTGAA
GAATTAAATAGGCAGCTGAATTCTACAGTGCAAGGCCTGC
AGGGGCGCGTGGAGTCATTAGAAAAAACCAACTCCAAACT
CATAGAAGAGTTGGCAATAGCGAAAAACAACATAATCAAG
CTGCAGGAAGAAAACCACCAACTCAGAACCGAAAATTCTG
TCATTCTAATGAAAGCACAACAACGTCTTGCGGTTACAGA
AGGAGATTTGAGCTGTGAGTTGGACACGTACAAGCAGTCA
AGGCAGGGCCTGGATGAAATGTACAACGAGGCTAGACGCC
AACTAAAAGAGGAATGTCAGCTCCGGCAGGATGTGGAGAA
TGAGCTGGTTGTGCAGGTGAGCATGAAGCAGGAGATGGAG
ATGGCCATGAAACTGCTAGAAAAGGACATCCATGAAAAAC
AGGACACTCTGATTGGACTCCGGCACCAGTTAGATGAAGT
AAAAGCCATCAATGTGGAGATGTACCAAAAAATGCAGTCT
TCAGACGACAGCATGAGACAGAAGAATGACATGATCGCAC
GGTTGGAGGAGAAGACCAATCAAATTACGGCAACTATGAA
ACAACTAGAGCAAAGATTGCAGGATGCCGAGAGGGAACGG
GCCAGTGCCGAAGACGGGGTGCGCAAATTCAAGCAGGACT
TCACAAACAAAGCCGAAAGTCTCCAAAAGCAGATAGTCCA
GAGAGAGAAGCAGATGACGCAGCTGGAAACAGACTTGAAA
ATCGAGAGGGATTGGCGGCAGACGTTACAGAATGAACTGG
AGAGAGAACGAGAGACAATCACCCAACTAGCTGCTGAAGC
TCAGCAAATCAACGGACTCAAAAAAGAGTTTCACAGGCTG
CAGGATGAGAACACACTGCTGAAGGGGATTTGTGAAGAGC
AGGAACATGCGCTGGAGGAACTGGGCTGCAAATTAAGCGA
GTCAAAGTTGAAAATCGAAGATATAAAAGAAGCCAACAAG
GCACTTCAGGGTGGACAGGTCTGGCTGAAGGACAAAGACG
CTACACATTGCAAGCTTTGCGAGAAGGAATTTTCAATCTC
CAGAAGAAAGCACCACTGCAGGAACTGTGGCGAGATCTTC
TGTAACGCCTGTTCAGATAATGAGCTGCCGCTTCCCGCTT
CTCCCAAACCCGTGAGAGTCTGCGACACATGCCACGCTAT
GCTCCTCCAGCGCTGCTCCTCCAACACCACATAAAACACG
ACGCTAACAAGTCCCAAAGTGGCCAAAATGGAGTTTACAT
TTCAGATGGGGGGAAAAAAAGCTTGTTGCTTCCGGTGCAG
ATGGCCAATGCGATGTTCGTCAGCGAGCGCGCAACGAGTT
TACAAATGGATTAATGACTCTTAACGCCTCCGTCTGGGGT
GCAAGTCGACCGATTTCAGGTTTTATATTAGCACAACACT
CCCATGCATTTTTGATATATGAAGGGTGAACCGGTTTCAT
TCCTTGTCAGTCAGAAGTCAATTCAGTTACTCGTTTCTTA
AGCAACTGTATTTCTGATTCAGTTCATTCATGTGTGCCTG
CATAACAAGCCAAACTGACAAGAGATTTGACATCATTCCA
GATGTTTGTATATGTACGGCAGAAGAGAAAATGTTGTCAG
TGCTGCTCATGAATGATTGAGGTTGATTCTCGTCAAATAG
CACAGAAACGTTGTTGTGAATACGATGTTCAGGTTTCTTG
TCTGCAGTATGGTATTATTTCACAACTGCAGATTTACTTT
GGTACAGAACTGGAACACTACTCACTTTGAGCATTTGTGT
TGACTTTTGTCTGAATAATTGTTCATAATGCAGCTGTTAA
CTTAAATGTGAAGTTTATGAAACTGTACATATGCCTTACA
CAACTAAAGTTGACTATAATTC

rufy2 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA rufy2-201 2902
rufy2-202 (1) 2692
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rufy2-201 Contained in:
OTHER rufy2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037652 (1)
  • Ensembl_Trans:ENSDART00000089133 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC155635 (1) 2926bp
    CITATIONS (2)