ZFIN ID: ZDB-TSCRIPT-090929-18039
Transcript Name: sfr1-201
Previous Names: meir5-001, sfr1-001, zgc:162162-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037636 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037636|OTTDARG00000027819|ZDB-GENE-070410-27 sfr1|OTTDARP00000030165 CH211-223P8.4-001 LG_ AL929005.7 Danio rerio protein_coding KNOWN, 1221 bp
AATAACAACGACGCAACAAGGTCCCGGAAGTGACGACGAA
ACAAATGGCACCAGTTTCAAAACAGCTGTGTTCACTGACA
ACTTTAGAAATGGAAGATCATATTCGCACAGAACTGCTTT
GGAGAGTACTAAATCACAAATGATAAAGTTATGTAGTCGT
TTTTTTCTTTTCGTATCTTGTAAAACATGGAGACAACCCC
GATAAAACCAACAGCAGCTGATGAAACTACGCCAAGCGCC
GAGCAGTCTTCAAACAGGTCCAGTACTGCAAAGCCCATGA
GTGCCTCGCTGAGGGAGAAGCTAAAAAGATCTCGACACTC
GTTCAAGTCTCCCCTCAGTGTGGTAAAACGACTCAAAATA
GAGGATGACACTGAGCCTCAGCCTTCACAGCAGGGAGAAG
AAGAGAAACACGGTGTCAAAGACGACAGAGACTCTAACGT
TACAGAGACTGATGTCAACAGGAATGACATGAAGCTGCAG
AGAGACTCGAACCACACAGCTGAGCTCCCCAGTCAGCAAT
GCGAAGCGCTGAGAAAAGCGGTGAAGGAGAGAACAGAAAC
CTTGAGGAGATTAAAGATGGTCAAGATGTACAGGAAAAAG
AATGACTTGAATGAGTTGCAGAGGCTCACAGACAAATGGA
GATCCTGTGCTCAGTCTGTGCTGTATGAACTACAGAGAGA
ACTGGCCACAGGTGGAAAACAAGCCAGTCTTTCACAACTT
ATTGACAGCTTTGGGATTAATGATAAACTACTGCACTTTG
ATAGGACAGAGGAAGACTTCACAGACACGTGAATACATTT
CAGCAATTTTTATTCACAGTTCAAACAGATTGCAGCGAGC
TTTGTTCATTAAAACGTTTGCGAAGAAAGATTGTCAATTG
ATTGAACTGTATAATAATTTATTGCACCTTTGTGTGTTGT
TTATTGTTTAGGTAAAGTTGTTGCGTTTTGTATGTAGAGT
CAGTTGTAGTGCAGTTGCGAGAGAGACGGGAAGTTCTTCA
TGCGCAGTTTCTCCAGCTCCGCTCTCAGCAGGAGCAGCTC
TTCAGACTGAGCTCTGGCGATGGCCAGCAGCTTCTTTCTC
AGGAGGATGTCCTGGTAGTTCTTGTCTGACTCTGTTTCCT
GGTTATCTTCCATTGCTGGAAAAAGAAAATGTTATCAAAT
TTTGTGAGCTGTTCAGGCTCCTATGCATTTTTAGCACCAT
TAATAAATATGGATAAACAGC

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
sfr1-201 Contained in:
[BAC] CH211-223P8 (1)

Genome Resources: Vega_Trans:OTTDART00000037636 (1),  Ensembl_Trans:ENSDART00000031564 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC133892 (1) 1116 nt
GenBank:CK676285 (1) 515 nt
CITATIONS (2)