ZFIN ID: ZDB-TSCRIPT-090929-18023
Transcript Name: mavs-203
Previous Names: mavs-002, zgc:158392-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037619 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037619|OTTDARG00000027811|ZDB-GENE-070112-1402 mavs|OTTDARP00000030151 CH211-1M7.2-002 LG_ BX323842.8 Danio rerio protein_coding KNOWN, 790 bp
GCATATCGAAAGTTAGTAGTAGAAGCCGCGAGAGGTAGAC
TGACCTTCATTTAAACGGGCTGATTTGAAATTCAGATTCA
GAGACTCAGAGAAGAAGCCATTGGATTTGACAGTTTAAAG
CAGAGTGAAAAATGTCACTGACACGTGAGCAATTTTATAA
CAAGGGAATTAGGCCGTATATGGGTCGTTTTGCAACAGAT
ATCAAAGTAAGAGAGATCTTACCTTATCTGCAATGCCTCA
CAATCTCTGATCGGGAAGAGATCGAAGCCAAGAAAGAACA
ATATGGAAACTACAATGCTGTGCAGACACTTCTGGACAAT
CTGCGCAGGCGAGAGAACTGGATTGATGAATTCATCACTG
CTCTGCGGAAGTGTGAACTTGGAAGTCTGGCTAATGAGAT
GAGCGACATTTATGACAGGATCAGGGGGATCACAAGTGGA
CCCAAACCTACAGATACTCTAGCTCCTTCTTTAACTGGAG
CCACAGCAACCGTTACAACGGCAACAGTTCACACTGTCCC
ACCTACTACTCTTCCTCTGCTAATGCCACCTGCAGGAGAT
GCCCCAGTACATTCAACTGCCCCTTGCAAACAAGCAACAC
AGGAACCGTCTCCTGATTCTGTTCTTCAAGTTGCAGAGAC
ACAGCAGGTGGAGCAAGTTTCTCCTCCAGCTCCGGCACCT
ACACCTGAACCAGTTCCCCAAACTGAAATCACACCACAAG
TTATAGCACCTTCCCAAGCAGCTCCTGACATGTCCTCACC
AATTAATTTAAAAGTCTTAACACACACTGG

mavs TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mavs-201 (1)    Ensembl 4397
mavs-203 790
mavs-205 (1)    Ensembl 744
ncRNA mavs-004 (1)    Ensembl 574
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mavs-203 Contained in:
[BAC] CH211-1M7 (1)

Genome Resources: Vega_Trans:OTTDART00000037619 (1),  Ensembl_Trans:ENSDART00000134421 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CV484752 (1) 799 nt
CITATIONS (2)