ZFIN ID: ZDB-TSCRIPT-090929-17990
Transcript Name: jag1b-201
Previous Name: jag1b-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037586 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037586|OTTDARG00000027795|ZDB-GENE-011128-4 jag1b|OTTDARP00000030124 jag1b-001 LG_ CU138575.8 Danio rerio protein_coding KNOWN, 6754 bp
AATGCGCAGTCAGTCAGTCGCGGACAAACGCTCTCATGGC
TTCTGTGTAATGTATACCCGCCGCTGAGAGAGAGACGCAG
AACAAAAAAGATAAGAATTTCAGATACGCTGGGAAAATAG
GAGGCAGTTTCCTACACACTGGAAAATAGTCTTCTGAAAG
AAATAAAAGTTGTTCTCCACCCGTGCATGTTCAATCGGGG
AGTACATTAGAGCCGTGAGGCGGCTACAACTTCTGAGTCT
CAAAGCAACACCAGCAAGAAGGCATGATTCTGCGACGGAG
TTCAGTATTTTCTGCTTTTTACCTTCATGCCTTTTTGTTA
TGCTTGCGGACGACGGTGTCTGACGCATCGGGGCACTTCG
AGCTGGAAATCTTATCGATGCAGAACGCGAACGGCGAGCT
GCAGAACGGCGCGTGCTGCGACGGCGCGAGGAACCCGGCG
GATCGCAAATGCACGCGGGACGAATGTGATACATATTTTA
AAGTTTGTCTAAAGGAATATCAATCGCGAGTTTCCTCGGC
TGGGGCTTGCAGTTTCGGAACTGGATCTACGCCCGTTCTC
GGTGGGAATAAATTTTCGACCAAGGGAACGCGCAGTGAAA
AGTCAAGGATTGTTTTACCCTTCAGTTTTGCGTGGCCGAG
GTCCTACACGTTGATAGTGGAGGCCTTGGACTTCAATAAT
GAGACCGCCAGTGAAAGTGGAAAGCTCATCGAGAAAGCGT
ACCACTCTGGCATGATCAACCCAAATCGACAATGGCAGAG
GCTCACCCATAATGGCCCCGTCGCCCAGTTTGAGTACCAA
ATCCGGGTGACCTGCCTTGAACACTACTACGGCTTCGGGT
GCAACAAGTTCTGCCGGCCACGTGACGAGTTCTTTGGACA
TTATACCTGTGATCAGAATGGAAACAAGACCTGTTTGGAA
GGATGGACGGGTCCTGACTGCAACACAGCGATCTGCAGAC
AAGGCTGCAGCACCGAACACGGATCATGCAAGCAACCAGG
CGGCTGCAAGTGTCTGTATGGCTGGCAGGGTCCATACTGT
GATAAATGCATCCCTCACCCGGGCTGTGTACATGGAACCT
GCGTTGAACCCTGGCAGTGTCTCTGTGACACTAACTGGGG
CGGACAACTCTGTGACAAAGATCTAAACTACTGTGGAACT
CACCAGCCATGTCTGAATGGAGGAACGTGCAGCAACACAG
GGCCTGACAAGTACCAGTGCTCTTGTGAAGACGGATACTC
GGGCGTCAACTGTGAACGAGCTGAACACGCCTGTCTATCC
AACCCATGTGCAAATGGAGGGACGTGCAAGGAGACCAGCC
AGGGGTACGAATGTCACTGTGCAATCGGCTGGAGTGGCAC
ATCCTGTGAAATCAATGTGGACGACTGTACACCTAACCAG
TGCAAACATGGAGGCACATGTCAAGATTTGGTCAATGGCT
TTAAATGTGCCTGCCCTCCTCACTGGACTGGCAAAACATG
TCAAATTGATGCCAATGAATGTGAGGACAAGCCATGTGTG
AACGCTAAGTCATGCCACAATTTGATTGGTGCATATTTCT
GTGAGTGTCTCCCTGGATGGTCAGGTCAAAATTGTGATAT
AAACATAAATGACTGTAAGGGTCAGTGTTTGAATGGAGGA
ACTTGCAAGGATTTGGTGAATGGATACCGGTGTCTATGCC
CTCCTGGTTACACTGGTGAACAGTGTGAGAAGGATGTGGA
CGAGTGCGCTAGCAGCCCCTGTCTGAATGGTGGGCGGTGT
CAGGATGAAGTTAACGGATTTCAGTGCCTGTGTCCTGCTG
GCTTTTCGGGTCAACTGTGTCAGTTGGATATCGATTACTG
CAAGCCCAACCCATGTCAAAACGGCGCGCAGTGTTTCAAC
CTGGCCTCCGACTACTTCTGCAAATGTCCTGACGACTACG
AGGGCAAAAACTGCTCTCATCTGAAGGACCACTGTCGAAC
CACATCATGCCAAGTGATTGACAGCTGCACAGTCGCAGTG
GCGTCCAACAGTACACCGGAAGGAGTGCGATACATCTCTT
CAAATGTCTGTGGGCCTCATGGACGCTGCAGGAGCCAAGC
TGGAGGCCAGTTTACATGCGAGTGTCAAGAAGGATTCAGA
GGAACCTACTGCCACGAGAACATTAACGATTGTGAAAGTA
ACCCATGTCGCAATGGTGGGACCTGCATCGACAAAGTGAA
CGTTTATCAGTGCATTTGTGCTGACGGTTGGGAAGGAGTT
CACTGCGAAATCAACATAGATGACTGCAGCTTGAACCCTT
GCCTGAACAAGGGAGCATGTCAAGACCTGGTGAACGATTT
CTATTGCGAATGTAGAAATGGCTGGAAGGGAAAAACCTGC
CACTCCCGTGATAGCCAGTGTGACGAAGCTACATGCAACA
ATGGAGGTACATGCCATGATGAAGGGGACACCTTCAAATG
CAGATGCTCACCTGGCTGGGAGGGAGCCACATGTAACATA
GCCAAGAACAGCAGCTGTTTGCCCAACCCGTGTGAGAACG
GAGGCACCTGTGTGGTCAACGGCGACTCCTTCAACTGCGT
CTGCAAGGAAGGCTGGGAAGGATCCACCTGCACTGAGAAT
ACCAACGACTGCAACCCACACCCTTGTTACAACAGTGGGA
CATGTGTGGATGGTGAAAACTGGTACCGTTGCGAGTGCGC
TCCAGGATTTGCCGGACCAGACTGTCGCATAAATATAAAT
GAGTGTCAGTCTTCTCCCTGCGCATTTGGCTCTACCTGTG
TTGATGAAATCAATGGTTACCGATGTCTTTGTCCACCTGG
AAGAATAGGACCGGATTGTCAGGAAGTTGTAGGGAGACCC
TGCATTGCTAATGGACAAGTAACTGCCGATGGTGCCAAAT
GGGAAGAAGACTGCAACATTTGTCAGTGCCAAAATGGAAG
GATTCATTGCACAATGATGTGGTGTGGACCAAAGTCATGT
CGCACAGGAAAGGCCAGAGGTGGATGTCCTGCAAGCCAAT
CTTGTGTTCCCATCAAGGAAGAGCAGTGCTTTGTCAAGCC
CTGTCCCAGTCTAGGAGAGTGTTGGCCCTCTGCACCCCCT
CCACCCTCTAAATGCCACGCCAGCTTCTCTTACCAGGACG
ACAGCTGTGCCAACATCACGTTCACCTTTAACAAGGAGAA
CATGCCTCAAGGCTTGAGTGTGGAACATGTATGTAATGAA
CTGAGGCACTGGTACCTGCTGAAGAACCTCTCGACAGAAT
ACGCGGTGTCCATCAGCTGTGAGCCATCTTCTTCAGCCAG
CAATGAGATCCACATCAGCATTTCCACAGAGGAGCCCAGG
ACAGACAGGAGTCCTATTAAAGACATAACGGTTCAAATCA
TTGACTTGGTGAGCAAGCATAATGGAAACAGCACCATCAT
TAAAGCCATCACCGGCGTACGGGTTCATCAGATACCAAGC
CCCAAAACTGACTACCTGGTTCCTTTGCTGAGCTCCATCT
TCATCGTGCTCTGGATCTTCGCTCTGGCCTCGGCTTTCCT
GTGGTGCATCCACCGGCGCCGGAAACAAAACACCCACAGC
AACACTGCTACCTCAGCCACAGAGGACAATACCACCAATA
ACGTGCGTGAGCAGCTCAACCAGATCAAAAACCCCATCGA
GAAGCACGCAGCTCACGGCGTGCCCATAAAAGACTACGAG
GGCAAGAACTCCATCATTGCCAAAATTAGGACGCATAACT
CTGAGGTGGAGGAAGAGGACATGGACAAACACCTGCAGAA
AGCGCGCTTCACCAAGCAGCCGGCCTACACGCTGGTGGAG
CGAGAAGAGCGCGCGCCAAACAAAAACCCAAACTGGACTA
ACAAACAGGACAACAGAGACTTGGAGACGGCACAGAGCTT
AAACAGGATGGAGTATATCGTATAGCAGGCAGCTGTGTTG
CCCCTGTTGCACTTACCGGTCACATGGCAGGGTTGTGCTT
CTGAAAACTGTTGCGTTGTGTTCTGGACTCCAAGGCTGTT
ATTTGCCCTGTGTTAATTTAAGTTTTGACAAGCTGGCTTC
ACACTGGCAATCAATAGTCGCTGTGGACGGCTGGAAAACC
CATACGCTGCGTTTCGCATCCAGTGTTTTCCTTCGTAAAA
GAGACACAAAAAGAAAAAACAGTAAAAAAAGAAAACGTAC
ACATTTCAAATGTTTATATTTTCGTGGATACGTTTGAGTA
TCTCAGTAAGTTTGCAAATAGTGTTATTTTTGTTCATAAT
GACAGTGCTCTCACAGCTAAAGTAGTTGTTTCTTCCTTAT
CCAGCGGCTGTGCGGAAACTCTCTCTAGTTGGTTTTATTT
CTAGTTCTGAACTGAAAGTGCCTTCACAGCTACGCACCAC
AGCAATTGTCGGAAAGGAGTATATTAAAAAAAAAAAATCA
AAGAACAAAAAAATTATTTATTATTTTTCTTTTCTTGGGG
CGGGATAGGTCGGTTAGCATTTCGCTGCCAATATGAAGAA
TCGTGTCAATTTAGTGTAGATATGTATATTTTTTTTAATT
AATCACTGTGTATATTTGATTTATTAACTTAATAATCAAG
AGCCTTAAAATATCATTCCTTTTTATTTATATGTCCTGTC
TAGTTTTGAAGGTTTTGATAGCTTTGTAAGCCTATAACTT
TGTTCAGACGACATTTGTTTCATGTTTCACACCAAAATTT
TCAAAAAGCAGTCGATTTTTTATTTTTAGAATGAAAAGAC
ACAACAATATATATTTTTTCTTTTTATACATTGTCGGATA
TTTCAATATTTTAAAACTTTTGTACAGTGCATCCGGAAAG
TATTCATAGCGCTTCACTTTTTGCACTTTTCTTGGTTACA
GTTGTATTCCAAAATGGATTAAATTTGTTTGTTTCTTCAA
AATTCTACACACAATACCCCATAATGACAATGTGAAAAAA
ATATTTTTTGAAATTGCTGCTAAATTAAAAACCTGAAAAA
TCACATGTACAAAAGTATTCACAGCCTTTGCCGTGAAGCT
CTAAATTGAGGTCAGGTACATTCTGTGTCCACTGATCATT
CTTGAGATGTTTCAGCAGGTTAATTGGAGTTCACCTGTGG
TAAATTCAATTGATTGGACATGATTTGAAAAGGCATACAC
CTGTCTATATGAGATCCCAGGGTTGACAGTGCATGTCAAA
GCACAAACCAAGCATTAAGACAAAGGAACTGTCTGTAGAC
CTCCGAGACAGGATTTTCTCAAGGCTGGGGAAGGTTACAG
AAAGATTTCTGCTGCTCTGAAAGTTCCAATGAGCACAGTG
GCCTCCATCATCCGTAAATGGGAGATGTTTGGAACCACCA
GGACTATTCCTAGAGCTGGCCGGCCATCTAAGCTGAGTGA
TCGGGGGAGAAGAGCCTTACGCCCTATTCACACAGGGCTT
CAGCATCAACGCTTGACTGAAGGAGTATCTGAAGTTGGGG
CTGAAACGATCGTCATAGCAGCGTCAGACACTGAAATTCA
GTCAGCAATAGACCATTGTCTAGCTGGTGTATTTGCATAC
AGCGATCTGATTGGCTGACGTTCAAAGTGAATGGGAAGCG
TTGACGCTGACGCCTTGTGTGAATGGGGCATTAGTCAGGC
AGGTGATCAGTAACCCTGATGGTCTCTCTGTCTGAGCTCC
AGCATTCTTCTGTGGAGAGCGGAGAACCTTTTAAAAGGAA
AACCATCTGTGCAGCAATTCACCAATCAGGCCTGTATGGT
AGAGTGGCCAAACAGAAGCCACTCCCTTCCTGGAATTTGC
CAAAAGGCATCTGCCAAAATATCAGTGGAGTGGCTTCACA
ACAACTTGATGAATGTTCTTGAGTGGTCCAGCCAGAACCC
AGACCTAAATCCTATTGAACATCTCTGTAGAGATCTGAAA
ATGGCTGTACACTGTCACTTCCCATCCAACCTAATAGAGC
TTGAGAGGTAATGCAAGGAAGAATGGGCAAAAATTCTTAA
ATACAGGTGTGCCAAGCTTGTGGCATCATATTCAAAAAGA
TTTGGAGGCTGAAATTGCTGCTAAAGGTGTATCAACAAAG
TATTGAGCTGTGAATAGTTATGATTTTTCAGCATTCTTAT
TTTTAATAAATTTGCAACAATTTCACAAAATCTTTTTTTT
CATTATGGGGTATTGTGTGAAATAAATAAATTGAATCCCT
TTTGGAATAAGGCTGTACATGAGAAAATGTAGAAAAAGTG
AAGCGCTGTGAATACTTTCCGGATGCATTGTGTGTATATT
GCCAACTCTTACTTGCTCAACGCAGGTAATATCAACAAAC
ATGGCTGCTTTTTGTTGGGATAATTAACGGCAGACACATT
GCTTGCCACGGTTGAAAAATAAATGATTGAAAAGTCTCCA
ATAAAAGGGAACACGAGTCTTCTAGTTGCTTGTTGGTAAA
CCCGATTGACACGGATCATTTCTCTTCAGCTTGGGTTTGC
AGTATGTCATAAGCTAGGCTGTGAATACTTGAACAGTAGG
GGGCCAATGGAAACACTGTAGACTGCCTTGCTTTCAGGAG
TCCATTTCTATTGCTGTGCACATGTAGTGTTCTTTTCGTA
ATTCTTTTATATCGAGGCTCTCTAAAACACCAAACCGACA
TGCTTATCACATTTGTCAATTCTATGAGATCATGGCAATA
TTCAATGTTCACATTTGACCTTATTGTAAATTTGTTTTCA
TTTTTTTTTTTTTTTTTAGTTTGTTCCTGGCAATATTTTT
TGAATGTTATATTTATTAAACATTTTGTATAAAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
jag1b-201 Contained in:
[BAC] CH211-159E5 (1)

Genome Resources: Vega_Trans:OTTDART00000037586 (1),  Ensembl_Trans:ENSDART00000019323 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AF229451 (1) 6857 nt
GenBank:AY221106 (1) 4405 nt
CITATIONS (2)