header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17984
Transcript Name: aldh5a1-201
Previous Name: aldh5a1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037580 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037580|OTTDARG00000027792|ZDB-GENE-070228-2 aldh5a1|OTTDARP00000030120 aldh5a1-001 LG_ BX005341.6 Danio rerio protein_coding KNOWN, 1918 bp
ATCAACACTAGAGTGTTGACATTTCCTGCTTTGCAGTTTG
CAGTGAGTGAAACGCAGAGTTGCATGCATAAGCAGTCGAA
AGAACTACGTGTTTAGCGGAAATTAATAACCGAGAATCTT
CTCTCGCATACATAAACAGTCGAGAGGAGAATGTAATTGC
TACAAACGAGTTTAAAATCGCATGTTAAGAGCGACTGCTC
TCGTTCTTTCACTGGACTAAGCTCCTCCTGCACATACATA
TCTATATATTTATAGATATAGGAGTGTGTCATTGTTTATC
ATGGCCAGTTTATGTCTCTCAAGAGGTCGGTGTGTCCTCC
GGCAGGTGTTAACTGGCTTACCGAGCATGGTGCAGTTGCA
GCGGCCGTACAGCCTCGATGTGTCCGCGTCGCTCCTGCGG
ACTGAAGGCTTCATAGACGGGCGCTGGGTGTCCGCGGCCT
CCTCCTTCCCCGTCTTTGATCCAGCCACCGGAGAGGAGAT
CGCCAAAGTCTCGGACTGCGGTACAAAAGAGGCTCAGGAC
GCTGTCAACGCCGCGCACAAAGCCTTTAACCTGTGGAAGA
ACCACACGGCCAAGGAAAGAAGTATTTTGCTGAGAAAATG
GTTTGATCTGATCATTCAGCACAGGGAAGATCTTGCCAAG
TTGATCACAGCAGAATGTGGGAAGCCCATGAAGGAGTCTC
TTGGTGAAATGACGTACTCTGCCTCTTTTCTGGAGTGGTT
TTCTGAAGAGGCCAGGCGTGTGTATGGAGACATCGTCGCG
GCTCCAGCCAAAGACCGCAAGATCCTGATCCTCAAGCAGC
CAGTTGGAGTGGCTTCCATCATTACACCTTGGAATTTCCC
AAGCGCCATGATAACCAGGAAGGTTGGGGCTGCACTTGCA
GTGGGCTGTACTGTAGTGGTGAAGCCGGCTGAAGATACGC
CTCTCTCTGCACTGGCCCTCGCTGAGCTGTCGGTTCAGGC
TGGCATTCCTGCTGGGGTGTTTAACGTGGTGCCCTGTTCA
AGAGAGAAGACGCCCGCTGTGGGAGAGCTGCTCTGCACAG
ACCCTCTAGTAGCCAAAATCTCATTCACCGGCTCCACAGC
CACTGGCAAGGTTTTATTAAGACATGCTGCAGGAACTGTG
AAAAGGGTCTCCATGGAATTGGGAGGACATGCTCCCTTTA
TTGTGTTTGACAGCGCTGATGTAGATAAAGCTGTTGCAGG
AGCCATGGGCTCAAAATTCAGAAACTCAGGACAAACCTGT
GTGTGCTCCAACCGCTTTTTGGTCCAGACTGGCATTCATG
ATGCTTTCGTGGAGAAGCTGGCGAAGACTATGGATGCAGA
GCTGAAGCTTGGCCACGGATCCGAGCCCAGCACCACACAG
GGGCCTCTTATCAACTCACGCGCCGCAGAAAAGGTGGAGA
AGCAGGTTGCAGACGCTGTGGATCATGGAGCGGTCGTAGT
TCGAGGTGGAAAGAGACTGCAGGGCTCTTTCATGGAGCCG
ACGCTGCTGTCCAACGTTACCTCTGACATGCTCTGTATGA
GAGAGGAGACCTTTGGACCTCTTATTCCAGTTGTTAAGTG
AGTGTTTTTTTAATTTATATAACTTCACAATATTATTATG
TAGCTTTTAGATGTTTCTACCCAAAGTTGCAGATGTAACT
TGTATAAGAAAATGTCATTTTGCGTAAATAATTTGCTACT
GTTTTCATCCAGTGCGTTTACTCGAATTGAATTTTGTACT
TTACAGTCACATTAGGGATGCTCTGATCAGCATTTTTATT
GCCAATACTAAGTACCGATTCCTTGTCATGGTGATCGGCT
GATATTGTGTACGGATTCTGGTGCTTTAAGCTGTATAATG
CACAAAGCACAATTTTCCTCTAAGTATGATATTTAAGTGG
AGATCTCCTAGAGAATAAATGAAGGATGTTGAATATTA

aldh5a1 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aldh5a1-201 1918
aldh5a1-202 (1)    Ensembl 1823
ncRNA aldh5a1-002 (1)    Ensembl 539
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aldh5a1-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037580 (1),  Ensembl_Trans:ENSDART00000109087 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC134910 (1) 1842 bp
GenBank:EH995878 (1) 945 bp
CITATIONS (2)