Transcript

aldh5a1-201

ID
ZDB-TSCRIPT-090929-17984
Name
aldh5a1-201
Previous Names
  • aldh5a1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037580 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037580|OTTDARG00000027792|ZDB-GENE-070228-2 aldh5a1|OTTDARP00000030120 aldh5a1-001 LG_ BX005341.6 Danio rerio protein_coding KNOWN, 1918 bp
ATCAACACTAGAGTGTTGACATTTCCTGCTTTGCAGTTTG
CAGTGAGTGAAACGCAGAGTTGCATGCATAAGCAGTCGAA
AGAACTACGTGTTTAGCGGAAATTAATAACCGAGAATCTT
CTCTCGCATACATAAACAGTCGAGAGGAGAATGTAATTGC
TACAAACGAGTTTAAAATCGCATGTTAAGAGCGACTGCTC
TCGTTCTTTCACTGGACTAAGCTCCTCCTGCACATACATA
TCTATATATTTATAGATATAGGAGTGTGTCATTGTTTATC
ATGGCCAGTTTATGTCTCTCAAGAGGTCGGTGTGTCCTCC
GGCAGGTGTTAACTGGCTTACCGAGCATGGTGCAGTTGCA
GCGGCCGTACAGCCTCGATGTGTCCGCGTCGCTCCTGCGG
ACTGAAGGCTTCATAGACGGGCGCTGGGTGTCCGCGGCCT
CCTCCTTCCCCGTCTTTGATCCAGCCACCGGAGAGGAGAT
CGCCAAAGTCTCGGACTGCGGTACAAAAGAGGCTCAGGAC
GCTGTCAACGCCGCGCACAAAGCCTTTAACCTGTGGAAGA
ACCACACGGCCAAGGAAAGAAGTATTTTGCTGAGAAAATG
GTTTGATCTGATCATTCAGCACAGGGAAGATCTTGCCAAG
TTGATCACAGCAGAATGTGGGAAGCCCATGAAGGAGTCTC
TTGGTGAAATGACGTACTCTGCCTCTTTTCTGGAGTGGTT
TTCTGAAGAGGCCAGGCGTGTGTATGGAGACATCGTCGCG
GCTCCAGCCAAAGACCGCAAGATCCTGATCCTCAAGCAGC
CAGTTGGAGTGGCTTCCATCATTACACCTTGGAATTTCCC
AAGCGCCATGATAACCAGGAAGGTTGGGGCTGCACTTGCA
GTGGGCTGTACTGTAGTGGTGAAGCCGGCTGAAGATACGC
CTCTCTCTGCACTGGCCCTCGCTGAGCTGTCGGTTCAGGC
TGGCATTCCTGCTGGGGTGTTTAACGTGGTGCCCTGTTCA
AGAGAGAAGACGCCCGCTGTGGGAGAGCTGCTCTGCACAG
ACCCTCTAGTAGCCAAAATCTCATTCACCGGCTCCACAGC
CACTGGCAAGGTTTTATTAAGACATGCTGCAGGAACTGTG
AAAAGGGTCTCCATGGAATTGGGAGGACATGCTCCCTTTA
TTGTGTTTGACAGCGCTGATGTAGATAAAGCTGTTGCAGG
AGCCATGGGCTCAAAATTCAGAAACTCAGGACAAACCTGT
GTGTGCTCCAACCGCTTTTTGGTCCAGACTGGCATTCATG
ATGCTTTCGTGGAGAAGCTGGCGAAGACTATGGATGCAGA
GCTGAAGCTTGGCCACGGATCCGAGCCCAGCACCACACAG
GGGCCTCTTATCAACTCACGCGCCGCAGAAAAGGTGGAGA
AGCAGGTTGCAGACGCTGTGGATCATGGAGCGGTCGTAGT
TCGAGGTGGAAAGAGACTGCAGGGCTCTTTCATGGAGCCG
ACGCTGCTGTCCAACGTTACCTCTGACATGCTCTGTATGA
GAGAGGAGACCTTTGGACCTCTTATTCCAGTTGTTAAGTG
AGTGTTTTTTTAATTTATATAACTTCACAATATTATTATG
TAGCTTTTAGATGTTTCTACCCAAAGTTGCAGATGTAACT
TGTATAAGAAAATGTCATTTTGCGTAAATAATTTGCTACT
GTTTTCATCCAGTGCGTTTACTCGAATTGAATTTTGTACT
TTACAGTCACATTAGGGATGCTCTGATCAGCATTTTTATT
GCCAATACTAAGTACCGATTCCTTGTCATGGTGATCGGCT
GATATTGTGTACGGATTCTGGTGCTTTAAGCTGTATAATG
CACAAAGCACAATTTTCCTCTAAGTATGATATTTAAGTGG
AGATCTCCTAGAGAATAAATGAAGGATGTTGAATATTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations