ZFIN ID: ZDB-TSCRIPT-090929-17960
Transcript Name: ntrk1-202
Previous Name: ntrk1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037551 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037551|OTTDARG00000027779|ZDB-GENE-980526-118 ntrk1|OTTDARP00000030097 ntrk1-001 LG_ CR933818.11 Danio rerio protein_coding KNOWN, 2663 bp
ACGGCTCAATAGCTCAGCTCCTGGATGGGATCATAACCCT
GAGTGCTGGCCAAGAGAAAAGCTGCGTCTTCTCACATCCA
GAGTTGTTGCTTGCAGGGTGGAGTTCCCCCCCAGGATAAC
AAACTCACTCCAAACCCCAGCATGGCTGACCATAGGGTGG
CCCCGGTTGTGGGTTTTCTCCTTTTTTTGGTTGCACCGGT
CTGGAGCGGATGCCCAAGCGCATGCCGCTGCTCCTTCGCT
ATGCTACAATGCCTGGAGTCAGATGGCATCACCAGCATCC
CGGCGCTGGCAGCGCAGGAGAGTGAAAACGTCACTGAAAT
CTACATAGAGAGTCAACCCAACCTGGAGAACATCACAGAT
GTAGACCTCGCCAACTACAGAGAACTGAAGAATCTGACGA
TCACAGATTGTGGGTTGGTGTACATCTCTGAAAATGCCTT
TCAGCATAACTTCAAGCTGCAGTATGTAAACCTGGCCTCT
AATGCACTGACGCACATCAGTTGGAGGGTGTTCCAATCTG
TGACTCTATTGAGTCTGATTTTGAGGGACAATCTGCTCAC
CTGCTCGTGTGACATTTACTGGCTTCAGCAGTGGCACAGA
AAAAGACTAAACGAAATTGATTCTCAGCAAAATTGCATTT
ACAATGGCAGCCAGATTCCGCTGGATTCATTCGAAATGGA
TAACTGCAGTGTTCCTGAGGTCATGATTGACCCACCGACA
GTGACCACTCAAGAAGGTGGAAATTTGACATTTACCTGCA
GAGTGACTGGAGTTCCCACACCGACGATCCACTGGAGAAC
TGAGCAGCTTCGGTCCAGCTGGACCCTGGAGCAAGGAATC
TGGGGATCAACCCTGGAGGTGGTTCTGCACATGAGAAATG
TGTCTTCTGCTGACAACCTGCACAACCTCACCTGTGAAGC
GGAGAATCGCGCTGGAATGGGAGATGCTGTGGTGCAGCTG
GACATTGAATTTCCAGTGCGGATCATATATCTCAAGAACC
CAGAATCTCAACATCACTGGTGTTTCCCGTTCGCCGTAGA
CAGCAATCCTCCCGCCAGCATCAAATGGCTGTACAACAAC
ATGCCTCTCACTGAGACCCGCTATGCCTACACTGAACTCA
TCAGAGACGTGTACGACGGCTCACAGCAACACGGCTGTCT
GTTCCTTAACAAACCCACTCATCTCAACAACGGCAACTAC
ACAATCATCGTGAAGAACAAACTGGGCAGAGACCAGAGAA
CAGTCCGAGCCAAGTTCATGGACAATCCTTTTGATCCCTC
TGACCCGGAGGGCATCATCCCTGTGCTCAATGACGACCCA
ACAGCTCCCACTAACCAATCAACGGAGACGGAGAAAATAG
AGAGCAGAGTGTTTGGGGTGTCAGTAGCTGTGGGCCTCGC
TGTGTTTGCGTGCACATTTCTGCTCATCATGGTTGTTGTC
ATTAATAAATGTGGACAGCACTCCAAGTTTGGCATCCACC
GTTCATCAGTTCTGGGCACCGAGGATGATCTGGCAGTGTC
TCTCCGCTTCATGAACTTCGGTGCTAGTCCTCCATCTTCA
GATGACGGCACACTGGATTCTGGCTTGTCCAGTTTTGTGG
AGAACCCGCAATATTTCTGTGTTCAGCACATTAAAAGAAA
AGACATTGTTTTGAAGTGGGAACTGGGTGAAGGAGCTTTT
GGCAAGGTTTATCTGGCTGAATGTGCCAATCTCTGTCCTG
ATACTGACAAGATGCTGGTTGCTATCAAGACTTTGAAAAT
AGCCAATGAGTCCACCCGGCAGGACTTCCAGCGCGAGGCT
GAGCTGCTCACGGTGCTTCAGCACGAACACATTGTGCGCT
TCTACGGTGTGTGCGCAGACGGAGAACCCCTGGCCATGGT
GTTTGAGTACATGCGACACGGAGACCTCAACCGCTTTCTA
AGGGCTCACGGTCCCGATGCTCGTATATTAGATGAGATGA
AGGTTCCTCCGATGGGTCAGTTGACTCTTCCTCAGATGCT
CCACATTGCCGCTCAGATCGCCTCAGGAATGGTGTACCTG
GCGTCCCTTCATTTTGTCCACAGAGACCTGGCCACAAGGA
ACTGTCTAGTGGGAGAAGGGCTGGTAGTGAAGATCGGGGA
CTTTGGGATGTCAAGAGACATTTACAGTACTGACTACTAC
AGGGTCGGAGGCAGGACGATGCTGCCCATTCGCTGGATGC
CACCGGAAAGCATTATGTACAGGAAGTTCACCACAGAGAG
TGACATCTGGAGCTTCGGAGTCGTTTTGTGGGAAATCTTC
ACCTATGGCAAACAACCCTGGTATCAGCTATCCAACAGTG
AGGCCATTGAGTGCATCACGCAGGGCCGAGAGCTGGAGCG
GCCTCGCACCTGCCCAAAAGAAGTGCACCTCCTGATGCAG
GGCTGCTGGCAGAGAGAACCACAGCAAAGGTTGGTCATCA
AGGACATCTACAGTCGCCTCGTGGCCCTCGTCAAAAACCC
ACCCGTCTACCTGGACATCCTGGAGTAGCAGTTGATCAGC
CCATAAAAAATGACACACTTCTGAAAGCAGGCTGAGAAGG
AAACAAACAAACAAAAAAAATCAATGGTGGGTTTTGGCAC
GGACAGAACGGACAAACTGTCTCAAATGTGTGCAGTATGA
ACATTTCCGGTGTTTGTTGACTT

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ntrk1-202 Contained in:
OTHER ntrk1-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037551 (1)
  • Ensembl_Trans:ENSDART00000128068 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC162577 (1) 2051bp
    GenBank:CD591862 (1) 500bp
    GenBank:CD591868 (1) 500bp
    GenBank:EB772114 (1) 417bp
    CITATIONS (2)