Community Action Needed: Please respond to the NIH RFI
Transcript

pax2a-209

ID
ZDB-TSCRIPT-090929-17934
Name
pax2a-209
Previous Names
  • pax2a-004
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037525 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037525|OTTDARG00000027765|ZDB-GENE-990415-8 pax2a|OTTDARP00000030075 pax2a-004 LG_none CT025909.13,CU104681.5 Danio rerio protein_coding KNOWN, 1190 bp
TATCCCATATAGGGCACGGCGGTGTGAACCAGCTAGGAGG
GGTGTTTGTGAATGGCAGACCCCTACCTGACGTGGTCAGG
CAAAGAATCGTGGAGCTCGCACACCAAGGAGTCAGACCTT
GTGACATTTCAAGACAACTACGGGTCAGCCATGGCTGTGT
CAGCAAAATTCTCGGAAGATATTATGAAACCGGCAGTATT
AAACCTGGAGTTATTGGGGGGTCCAAACCAAAAGTGGCGA
CGCCCAAAGTTGTGGAAAAAATCGCAGAATACAAGCGGCA
AAATCCTACAATGTTCGCCTGGGAGATCAGAGACCGACTC
TTGGCCGAAGGCGTTTGTGACAACGACACAGTACCAAGTG
TTTCATCTATAAACAGGATAATTCGAACCAAAGTTCAGCA
GCCTTTCCACCCATCCTCCGACGGCACAGGAACACCTCTT
TCCACAGCGGGACACACTATAGTGCCCAGCACAGCCTCCC
CACCTGTGTCAAGCGCTTCCAATGACCCCGTGGGGTCCTA
CTCTATTAATGGCATCCTAGGAATCCCTCGCTCCAACGGC
GAAAAGAGAAAACGTGATGATGTTCTCTGGAGTGGCAACC
ACTTGGATGGGAGGAAAATAGGATATTATGGTTCAGATGG
CTCTGGCCCTAACAGTGATTCTCAGGGTAGTGTGGAGAGT
TTACGGAAGCACCTGAGGGCTGATGCCTTCACTCAACAGC
AGCTGGAGGCTCTGGATCGGGTGTTTGAGCGGCCGTCATA
CCCCGACGTCTTCCCCACGTCAGAACACATCAAGCCAGAG
CAGGCTAATGAGTACTCGCTACCAGCACTGAACCCTGGAC
TGGACGAAGTCAAGCCCAGTCTGTCAACCAGCGTCAGCTC
AGATTTGGGCTCCAGCGTGTCACAGAGCTACCCAGTAGTG
ACAGGTCGAGAGATGGCGAGCACGACCCTACCAGGATATC
CACCTCACGTTCCCCCTACTGGGCAGGGCAGCTACCCCAC
CTCTACACTTGCTGGAATGGTCCCTGGAAGCGACTTTTCA
GGAAATCCCTACTCTCACCCGCAGTACACAACTTACAATG
AAGCTTGGCGGTTCAGCAACCCCGCGTTATTAAGTTCCCC
TTATTATTATAGTGCCGCATCCCGGGGCTCCGGGCCTCCC
ACTGCTGCCACTGCCTATGACCGCCACTAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations