Transcript

atrip-201

ID
ZDB-TSCRIPT-090929-1784
Name
atrip-201
Previous Names
  • atrip-001
  • si:dkey-42i9.5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010643 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010643|OTTDARG00000009275|ZDB-GENE-050208-331 atrip|OTTDARP00000009166 DKEY-42I9.5-001 LG_ BX465868.6 Danio rerio protein_coding KNOWN, 2552 bp
GCTTGAATGAATACCGAACCTTCAGAAATGCCTCCAACTT
TTCCTCTTTTCGGTTATTTGTTTGTTTGGTCAACTACTTT
TATGTAAACATTTCAGAATTGCACTTTATCTGGAGTGTTT
ACTTTTGGTTTGTCATGTCGGTGATTTGACGGGCAGTTGC
AGGTTATGCAGGAATCTGAGGAGCGTAAATCAAGCAGGAG
CTCGTTGACATGGACTTTCCCCCGAGCAAGAGACTGAAGG
GCCCTCAGGTGAAGACTGGACCCGACCCGTTTGACGATGA
CATTGATTTCACCCAGGATGATCTGGAGCAGATTGATATT
ATTGCGTCTCAGGCCATCAGCGCAGACGTCCAGAACAGCG
GCTCTAAGAGATCTTTCGACGCTGTGCTCGCTTGCGCTGA
TGAACCGAGCAAAGCTCCAGTGAGGTCCGGGCGGAAAACA
TTCGCCCTTGGAGATGCCTGCAGCAGCAGCACTTACAACA
ACACACACGCTCAAAGGAAAGAGCCTTCTGCAGATGGTCC
TTCCAGTAAAGATGGGGATGATCTCTATTACAAACAATTA
GAGGAGCAGCAAGCAGAGCTGAAGAAAAAGCTGAAGGAGG
TGGAGGAGGAGATCTTGATGAAGAACGGGGAGATTCGAGT
GCTGCGGGACTCTCTGAAACAGGCTCATCAGGAGCGCGAG
CAGCAGCGGCAGGCGCAGATCATCCTGGAGAAGGAGAAAA
CTCAGGCTCAGAGCGACCGAGAGAAGGAGCTCTCCAGGAA
GGTGCAGTCGCTGCAGTCGGAGCTGCACTTTAAGGAGGCT
GAGATGAACGAGATGAGAGGGAAACTGCAAAGCGTGGAGC
GTGGAGGAAAGCAGAGCGGCACACCTGCACGACAAGCTGT
TAAGTCTCCTTTAAGTCGAACGTTCATGACGAAGGAAAAC
TTCTCCGCCGAAATCTCAAAGAGAACGTCTCCTGTCAAAC
CAGGCCCTTCATCAGACAATGCAGCACTGTCCAGATGTTT
ACTCCCAGAAGAGCAGCGATCGCAGCAATGCATCGCCTCT
GATCTTCAAAAGGAAGGATGTGTGTTACTAAAGCTGCTCC
TCCAGCAGCCTCTGGATCCCAGTGTTCTGGGTCTCTGTCA
TCTGCTGTCCATCAGTCCTGACGCTCTGCCCAATATGCTG
ACACAACACGGATACATCAGTCCTGGATCATTGTCGACCT
CCAGCTCGTCCTCCACAGACCTCCGCTCATTTCCTCGTTC
TCCGTCTCAGTTCCACCACCTCCAGAGTCTGGCCATGTCC
GCTCTCACAGCACTCTCTCTCCATGAGCCTTCCACTGTCT
CTCGCCCCTCATCCTGCCCATCAGCAGTGCACTTCCTCCC
CCTGCTTTCCTTCCACATCAGCACCTACTGTCAGTCTCTA
GAGGTCTTCGACTCCTCCACCAAATCCTCTCTCCACAGCG
GCTCTCTGTCCGGCTCTTCAGACTCCAGCCTGAGCTCCGT
CCTGGAGGAGTCTCTGAGCGGACAGGAGGAGTTGGCTCTG
GCGGCCCTCAGAGCGCTTCAGCACATCGTCTGCTACAGTA
AAGAGGCTCTGGAGGATGTGATTCGGATGCAGACTCCTAA
AAACATGCTTGGGGAAATTCAAAATCAGATGCCGGTCCTG
AGGAGGCTTTTACAGCTTGCAGATCCGGCGTTCAGTACCG
CCGCGGGACACCGGGAGGCGCTAGTGAGCTGCAGTTGGAG
GATTCTCAGTGTGCTGGCAGAGAGAGCAGAGGATAACCTG
ATCTCCAGGCTCCAGGTGGTGATGTCCAGTCCAGTGCTGT
CTAAATGCCTGACTCTGGAGACCACCTACAGTATCGTCCA
TCTGTGTGTGAGATTTCTGTCGTTTATCATCTGTAATGAC
GAGATGGCCTCTAAGCTCTGCTTGCATGACTATCCGTGTC
CTTTTCTTAAAATATTCCAGTACGTCACATCCAGACCGGA
TAAATCCTCTACTGAGGACGCGTGGAGTCGCTTGGAGCTT
GTGGTCATCCGGTTATTGACTAAGCTGTTCACACAGAGGG
CAGGAACATGGGCGGCTCTTTGCGAATCATCATGCCAGTG
TGTTAATGAGGTGGTGCGGACGGTCGTTGTAGTTTTACAC
CGACAGTGGCTGAAAACGAAATGCAGAGGAGGTCAAACGG
TGGGTACACAGATCTGGTCCAGTCCTGGATTGCAAGTACT
GAGAGAAGCACTGATGTTACTGCACTGGCTGCTGTTGAAG
GATTCAGCATTTTCCGAACACTGTCTGGACGTCTTACACA
TGTACGATCAGGTCATTCCCGCCATCAGGGACACTTTCCG
TCTGCTCCCAGATCTGTCCGAGAGCGAAGAACTGGCTCTG
GAGGAGATCTGCAGGTCTGAAACGGAGTATGTTGAGGACA
TGGATGTGGAAACAGGGTCATAACAATCAAATATAAAGTC
AAATTTTGTAACAAACGATGAAAGTTGGTAGAAGCAGTCT
GATTTTTTGTCTCATGTCCTCATTTTTAAGACTACAGAAC
ATTGATGATTGGAAATTAAAGAATTAATTGTA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations