ZFIN ID: ZDB-TSCRIPT-090929-17753
Transcript Name: rs1a-002
Previous Name: rs1-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037330 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037330|OTTDARG00000027664|ZDB-GENE-040801-171 rs1a|no_translation rs1-002 LG_ CR790368.17 Danio rerio protein_coding KNOWN, 808 bp
AAAACCATCTTGACTATGGAATCTGTGAATTTGTGGTTTT
TCCCCTAGATGTGCCTGGCTGTCCAAGTTCCAGGACACCA
GCCAGTGGCTTCAGATTGACCTGAAGGAGGTGAAAGTGGT
TTCTGGTATCCTGACCCAGGGCCGCTGTGACTCTGATGAG
TGGGTTACCAAGTACACTATGCAGTACCGCATTAATGACA
ATCTCAACTGGATCTACTACAAAGACCAAACTGGAAACAA
CAGGGTGTTCTATGGGAACTCTGACCGCTCTTCCACAGTC
CAGAACCTGCTGCGTCCACCAATCGTAGCGCGCTACATCC
GTATCCTCCCTCTTGGCTGGCACACTCGCATCGCCATGCG
CTTGGAGCTGCTGCTTTGCATGAATAAATGCACCTGAGCT
AGCTAATAAGCAAAGCCATTCCTAACTATTTCCTGTACAC
CATCCATTCATTTCTATCACAACATGCCAAAGTGAATATC
ACTAGCCAATCTTGTTTTATGTATCATCTGGTATGGATTT
CAATCGCTTTTAATTTTATTTATGTGTTTAATTTAACGTT
CTGCGTCTAACTGGTTGATTATTTGATTATTCACATATTT
TTCTTCAGTTCATGGAAATTATTGTTAGATTATGTCATGA
GTAAATTACTTCATGCTTTTTTTTTCATGTCATTTTTTTT
TTAAAAGTAAAATAAGTATTGCTTTGGCAAATCAGGTTTG
TTTACATCCAATGCATGTTGAAGCCATAATGTTAAACCAG
ATATTCAATCCGGGTATAGAAATAGGGAGATCCATTGGAG
TTGAACTC

rs1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rs1a-002 808
mRNA rs1a-201 (1) 1325
rs1a-203 (1) 715
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rs1a-002 Contained in:
OTHER rs1a-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037330 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK354914 (1) 797bp
    CITATIONS (1)