ZFIN ID: ZDB-TSCRIPT-090929-17752
Transcript Name: rs1a-201
Previous Names: rs1-001, rs1a-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037329 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037329|OTTDARG00000027664|ZDB-GENE-040801-171 rs1a|OTTDARP00000029909 rs1-001 LG_ CR790368.17 Danio rerio protein_coding KNOWN, 1325 bp
ACAGTAATCCAGCCCCTTTAACATCAGTGCGGTGGTCCAC
CACTCGAAAAATAAACATCATGGAGTACAGACTGCAGAAC
ACGTTACTGTTAGCCATCCTGCTGGTGTCTCAAGGTTTTC
TTGGTCTGCAGGCACAAACGGATGGCGAAAGCAACGATAC
ATGGGCTGGAAAATCCTGCAAATGTGATTGCGATGATTCC
TCCAGCAAGATGCTTTCCAAGGGTTCATCAAGTTGGCCAC
AGGAGATGGGCTGCATGCCAGAGTGTCCCTACCATAAACC
TCTGGGTTTTGAGGCAGGATCTGTGGCTTCAGATCAGATC
AGCTGCTCTAATGAAGACCAGTACACAGGCTGGTTCTCCT
CCTGGACGCCAAACAGGGCAAGACTAAATAGCCAAGGATT
TGGATGTGCCTGGCTGTCCAAGTTCCAGGACACCAGCCAG
TGGCTTCAGATTGACCTGAAGGAGGTGAAAGTGGTTTCTG
GTATCCTGACCCAGGGCCGCTGTGACTCTGATGAGTGGGT
TACCAAGTACACTATGCAGTACCGCATTAATGACAATCTC
AACTGGATCTACTACAAAGACCAAACTGGAAACAACAGGG
TGTTCTATGGGAACTCTGACCGCTCTTCCACAGTCCAGAA
CCTGCTGCGTCCACCAATCGTAGCGCGCTACATCCGTATC
CTCCCTCTTGGCTGGCACACTCGCATCGCCATGCGCTTGG
AGCTGCTGCTTTGCATGAATAAATGCACCTGAGCTAGCTA
ATAAGCAAAGCCATTCCTAACTATTTCCTGTACACCATCC
ATTCATTTCTATCACAACATGCCAAAGTGAATATCACTAG
CCAATCTTGTTTTATGTATCATCTGGTATGGATTTCAATC
GCTTTTAATTTTATTTATGTGTTTAATTTAACGTTCTGCG
TCTAACTGGTTGATTATTTGATTATTCACATATTTTTCTT
CAGTTCATGGAAATTATTGTTAGATTATGTCATGAGTAAA
TTACTTCATGCTTTTTTTTTCATGTCATTTTTTTTTTAAA
AGTAAAATAAGTATTGCTTTGGCAAATCAGGTTTGTTTAC
ATCCAATGCATGTTGAAGCCATAATGTTAAACCAGATATT
CAATCCGGGTATAGAAATAGGGAGATCCATTGGAGTTGAA
CTCAGTGTTGTGTTACTGTTTTTCTGTTGTGGTTTGTGAC
TGTTTTTGCTTGTAATTCCCACTGACCGATTCCTTTTTAT
ATTCATTATGAGCCTGTACTGTTAAACTGTGTTTGTGGCT
TACCTGAGAAACAACACAATTGAATAAAGGAAGTCTTTCT
CCGTA

rs1a TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA rs1a-002 (1) 808
mRNA rs1a-201 1325
rs1a-203 (1) 715
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
rs1a-201 Contained in:
OTHER rs1a-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037329 (1)
  • Ensembl_Trans:ENSDART00000036050 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC076183 (1) 1331bp
    GenBank:EB786210 (1) 478bp
    CITATIONS (2)