Transcript

rdh5-202

ID
ZDB-TSCRIPT-090929-1775
Name
rdh5-202
Previous Names
  • rdh5-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000010539 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000010539|OTTDARG00000009177|ZDB-GENE-050208-411 rdh5|OTTDARP00000009073 DKEY-102C8.5-001 LG_ BX324213.8 Danio rerio protein_coding NOVEL, 1321 bp
AAAAGGCAATTGTTTACAAAACATCTCCGCAGAGCCACTC
AGGAGGTAGAAGCGATGTATGAGTTCTTGAGCTGTCCCAG
CACATATGCATTGGGTACGTTTGCGATTCTGTGGGTTCTG
GTATGGTTCTACCGGGACAACCTAAAGATCACTAGAGTCT
CAGAAAAACATGTGTTTGTGACCGGTTGTGACTCTGGTTT
TGGTAACCTACTGTGCAAACGTCTGGACAAACGTGGTTTC
CGCGTCCTAGCCGGGTGTCTTACGGAAAAAGGCGCAGATG
ATCTGAAAAGAGCCGCAGGACCTTTCTTGAAGACCTGCAT
TTTGGATGTGACCAGCTCGGCTAGCATCCAGAAGGCTATG
GAATGGACCAAAAAAGAAGTTGGAGATAAAGGACTTTGGG
GTTTGGTGAACAACGCCGGACGTTCCCTTCCAATGGGTCC
ATCGGAGTGGATGAAAATCGAGGACTTCGAAAGCACGCTC
AAAGTCAACATGACTGGTGTGATCGAGACCACCATGACCT
TCTTACCACTTGTGAAAAAGGCCCGTGGACGGGTTGTAAA
TGTGGCGTCGGTGTTGGGTAGAGTTGCAGCTAATGGCGGC
GGGTATTGCATCTCGAAGTTTGCAGTGGAGAGTTTCTCCG
ACTGTCTCAGGAGGGACATTCAGGGTTTTGGGGTCAATGT
TTGCATCATCGAACCTGGTTTCTTCAAGACGCAGGTGACC
AGCCTGGAGCCCATCGAGAGGGAACTTCATCGTCTCTGGA
ACCAACTGACTCCTGAAGTGAAGGAGAGCTACGGAGACAA
ATACTTGGATAAATACATCTGGATCCAGAGGCTGATCATG
AACGCCATCTGCGACTCTGACCTCAGTAAAGTGACCAACT
GCATGGAGCACGCTCTGCTAGCCGTCCACCCAAGAACTCG
CTACAGCGCTGGCTGGGATGCCAAGTTTTTGTGGATCCCC
TTGTCTTATATGCCTGCTTGCTTTGTCGATATTGCCTTGA
AGCTGGTGATGCCAAAACCAGCAAAAGGTGTTTAAATTTG
GAGTGCGGTTAAAAAAGGTTATTTTAGACCAGAAGCTCTT
AAACTCTTACTATTGGTTTCTTTCTTATACACTGGATGCC
GCTTCATTTTGGGGTTTTGACTAGATGACTGTGAATTTAG
TTATGTATTTATGAGATCTAAATTTATATATTTATGAATA
ATTAAGTGTGTCCATATTACTTTCAACACCTTGCCCTTAT
TTCTTGTTTCTCAATGGCATTTATTTCTCTTGCCTAATAA
GTGACTTTTGCCTGAACTTGCCTTAAGTCAAATCAAATAT
T

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations