Transcript

esrp1-201

ID
ZDB-TSCRIPT-090929-17721
Name
esrp1-201
Previous Names
  • esrp1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNACentral
Note
None
Sequence
OTTDART00000037297 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037297|OTTDARG00000027646|ZDB-GENE-070112-1732 esrp1|OTTDARP00000029885 rbm35a-001 LG_none BX537166.6,BX511010.5 Danio rerio protein_coding KNOWN, 3669 bp
GAGCAGCCATTGCGGAGCAGAGCCACGGGTTTCGGACTGT
TTTGCATCGATTATCGCGCAATTAAAAGGCAACTGGACGC
AATAAGGCGAGTCCGAACCCGGCACTGATCTGTCCGTATT
GGTGTGGGGGTCACCGGGCTCTTCGCTTCTCTGTCACCTG
GATTTGATCTCTAGGGTTTTGCTTTTGCTATCGGGGTGGT
GACAATAGTTTTTTTTCTTTCTTAAAAATGACGGTTAATC
CCGACTATTTGGTGCTTTTATTCACCACCACATCTGGAGC
AAGTGGGGATAAGTTGGGATCAGATGAGAAGGAAATTGTA
CAGCTGGTTTGGCAAGTTGTGGATTTAGCAACTAAAAAGG
CCGGTCAGGTAAATGAACTGCTAGTCAAACCGGACCACAT
TGAACTCTCGGAAGAGTGTCAGGAGCTCAGCGGACTCACA
GATGAGGCTTTGACACCTGTAGATCCCCTCGAAGTCGCCA
TTGATCAGTTGAATCAGAGGTTGTGTGCTGAAGTGGACAC
AGGTGCAGGAAACACCTTCTACCTGTGTACGGATGGACAG
CTTCACGTGCGTCAAGTCTTGCATCCCGAGGCTTCCAGCA
AGAATATTTTGTTGCCGGATTGTTTCTTCTCGTTCTTCGA
CCTGCGGAAAGAGTTTAAGAAAGAATTCCCATCAGAAGTG
AAGCTGAAAGACTTGAATCTTCAGGTCATGGCTGACCATC
TGAATGTGGCTGTGGATTCTTCTCTTCATGCTTTCACTGC
ATACAAGGTTCAGCAGATGGTGGATATTGTTTTAGCGCTC
ATCTCAGAGCCTACCTGCCACGAATTCACTTTTCCTGAAA
AAGTGAATGAAAAGTTTGAGACAGGCACCTGCAGTAAAAT
GGAGAGAGTGGATGATAACACAGTGATCAGAGCTCGGGGT
CTTCCATGGCAGTCTTCAGACCAGGACATTGCACGGTTTT
TCAGGGGCCTCAACATCGCCAAAGGAGGTGCTGCGCTGTG
TCTAAATGCTCAGGGCAGGAGGAATGGAGAAGCATTAGTG
CGGTTTGAGAGTGAAGAGCACAGAGATTTGGCACTGCAGA
GACACAAGCATCACATGGGGGGCAGATACATTGAGGTTTA
CAAGGCAACAGGTGAAGACTTTCTAAAGATAGCAGGAGGT
ACCTCTAATGAAGTGGCCAGTTTTCTGTCAAGGGAGAATC
AGATTATCGTCCGCATGCGTGGACTTCCGTTCAATGCCAC
CGCAGAGCAGGTTCTGCAGTTCTTCTCCCCAGCTTGTCCT
GTGACGGACGGCAGCGAAGGCATTCTATTTGTACGTTTTC
CCGATGGCAGGCCCACTGGGGATGCATTCGTCCTGTTCTC
CTGCGAGGAACACGCTCAGAACGCACTGAAAAAACATAAG
GACATGCTGGGAAAGCGATACATCGAGCTGTTCAAGAGCA
CAGCTGCTGAGGTGCAACAGGTACTCAACAAATACTCATC
TGCCCCATTGATTCCTGTGGCTCCATCCCCGATCCTGTCT
GTTGTGGCGCCACCCACATTCGTACCCCAAACAGCAGCAG
TCCCAGGTGTTCGGGACTGTGTGAGATTGAGGGGCCTACC
ATACGATGCCTCCATCCAGGATATCTTGGTTTTCCTTGGG
GAATATGGAGCTGACATCAAAACACATGGAGTGCATATGG
TGCTTAACCATCAGGGTCGTCCGTCGGGTGAGGCTTTTAT
CCAGATGCGGTCAGCAGAGCGGGCATTCCTAGCAGCCCAG
CGCTGCCACAAGCGCAGTATGAAGGAGCGTTACGTGGAGG
TGTTTGCATGTTCTGCTCAGGAGGTGAACATCGTGCTGAT
GGGAGGAACGCTCAACAGGAGCGGCCTCTCGCCGCCGCCA
TGTCTGTCTCCTCCATCTTACACGTTTCCTCACGGGGCGC
CGGTTCTTCCAGCCGGAGCAGTGCTTCCTGCAGGAGCAGT
GTTACCAGTGGAATCAGCAGGCATTTACCCCTCCCAGTTC
CTGCTTGGTCCCCGACCCCCTCCGCACACCACCACATTTT
ATCCGGCCAGCAACACACTCTACATGAACTACACCACCTA
TTACCCAAGCCCACCAGGCTCCCCATCCAACATCAGCTAC
TTCCCCACTGGCCACACCCCTTCGGCAGGCTCAGTCCTCT
CAGCCCAGCCCACAGCACTGATTCGAATGCAGGGCCACGC
CCATTCTCATGCTTATAATAACGGGGTTAAAGAGATCCTC
AGCATGGTGCAGGGATATCAGCCTGGCAACAGCGACGCTT
TTGTAACTTTCCCTTCTATGCTGTCAGCAAAGCAGCCTAT
TGGAGACCAGACTGTAGGAGGCGGAGCTTATCTTGACTTG
CAGTTGCTTTAAGCCAATCTATTGACAAGGCCACGCCCCA
AAGGCGAATTCAACAACCCCCTCAAAACAAAGCAGTTTAT
GCCATTTATGCTATTTATATGAGAATTTTTAATAAGAATT
GTATGTATTTTGACGTTTATGTATATTGCACATTGTTTTT
TTTTATGCATTAGAGCTAATGATATTCTTTCATAAGTTTG
TATGTACATGCACATGCAGCGATGTTCACTCAGGAAATAT
AGCTTCTCAAACCAGGGTCCAATCCATAAACTTGCCAAAC
CAAAAGGCAGATTCTCACTGATACCATAAATTTAAGCCAA
AGGACCAGTAATACAATATAAAGCGTGCATGTGTATGAGT
GAGTGTGTTAGTGCTCCCTGTTGATGTGACTCTACCGTGA
GTATGTGTGAATGCGTAGAGACCTTCTCAAGCCTCTCTCT
CTCTCTCTTTTTAATCTTTGAAGGTTTTAATTTGCATGAA
GTTCACAGAGCTAGCTGTTTTAATGTTTACAAGATTCGCC
AAATCCTCACACCGTGCACAATGCAGTTCGTGGATGTCTG
CAACTTAGTCATTTCACCAAAAGAAACAGCTCACAAATGG
AATCAGGAACAACTGTTGTGCTTTATACATGTACTGTTGT
GTCTATGTGTCATGCATCGGAAAAAAATGTGTATCGTCCG
TACCAATCAATGTACAAAATTCTATCGATAAACGTGCTTG
TTGATTTGTGTATGTGAGTGTGGTAGATGTATTCCAGTGG
ATGAATGAGTATGTGTATGTGTGCGAGTAGGTGTGCGCAC
CGTAAAAGTCAATGCATGTGTGTTTATTTACTGCACTCAG
AGAGTGTTTTCGGGCCTGCTGTAATGCACACAGGTGTATT
CTCACCCATTGTCTGTGTATTAGGAGGAGTGTTTGTGTGC
ATCTGCTGGAATGTGAACAGGTTTATTTGTTACCTGCAGC
TGTATCCCATCTGTATCCTCCTGTTTGTTTATGCCAACAT
GCCTCATTTATTATACTCTGTGCTTTTTTGTTTTGTTTTA
ATACTAGGAATGATTTGCATGTTTAGGCTTTTATGAGCGG
TAGGAGTAAAGCGTATGACAGCGGAATAGTCAGTGTGAGT
TATTTGTACTAGTACCCACACATGCCAAAAAGGCAGTAGT
AGCACTACTCATTCATGTTACCAATCTGTTACCATCTTAT
TTTGTAAATCCTGAGTAGAAAAGAGGAATCGAGAATTTGG
CTGTTTGGAGAAAGTATTATTTTATTTTGATATTTTATAA
TAACTTAAAATAAAGGAAATTTAACAATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations