Transcript

hoxa13b-201

ID
ZDB-TSCRIPT-090929-17679
Name
hoxa13b-201
Previous Names
  • hoxa13b-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037253 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037253|OTTDARG00000027625|ZDB-GENE-980526-365 hoxa13b|OTTDARP00000029854 hoxa13b-001 LG_ CR392024.15 Danio rerio protein_coding KNOWN, 1546 bp
AGTCTTGGGGAATTCTAAAAGAGCTGCTGGGCTCCATGTA
GGGCGTGCTATGACAGCGTCTTTACTCCTCCATTCCCGCT
GGATTGACCCGGTGATGTTTCTCTATGACAACGGTTTGGA
TGATATGAGCAAAAACATGGAAGGATTTGTGGGAGGCAAT
TTTGCTGCGAACCAGTGTAGGAATCTCATTGCCCATCCGT
CTACTTTGGCTCCGAGTACAACCTACACATCGAGTGAGGT
GCCAGTGTCGGGCATGGGAGAGCCTGTCAAACAATGCAGC
CCGTGTTCGGCCGTGCAAAATACCCCAAGTGCTTCTTTGC
CCTATGGATATTTTGGCGGCAGCTATTACCCGTGTAGGAT
GCCCAAGTCCTGCACGCAACCCACCACATATGGAGAAAAA
TACATGGACACTTCTGTTTCTGGAGAGGAGTTTCCTTCTC
GAGCAAAGGAATTTGCTTTCTACCAGGGCTACTCGTCTGG
CCCTTACCAGCCTGTACCAAGTTACCTTGACGTGCCAGTT
GTACCTGCGCTGAGCGCTCCTTCGGAACCGAGACATGAAT
CTCTACTGCCTGTGGAAACGTACCAGCCGTGGGCAATCAC
TAACGGGTGGAGCAGTCCAGTGTACTGCCCGAAAGATCAA
ACACAGTCAAGTACCTTGTGGAAATCGTCTATCCAAGATA
CCGTGTCAGGTACCGATGGAGCCTCAGTACGTCGAGGGAG
AAAGAAGCGGGTTCCCTACACCAAGGTTCAATTGAAGGAA
CTAGAACGAGAATATGCCACAAATAAGTTCATCACAAAGG
ACAAACGAAGAAGGATATCTGCTCACACAAACCTGACCGA
GCGACAAGTGACCATCTGGTTTCAGAACAGGCGGGTAAAA
GAAAAGAAAGTGGTCAACAAGTACAAGGGCATCAGTTAAG
TCCTGGAGATTATTAAAACTGAAATACAAAAAGTGGTGTA
AATGGAAGGACAATCACCATTATTTATTTTGAAATCCATT
CCACCATCTGTTCCACGTCACGAGACTATGCGGAGATGCG
CAGGAGGGAAAATGTAAATTTCAATTTCCTGTGTACATAT
TGCCAAGACACTGACATTGATCAAACGCAAAGATAGTGCT
CAAGAACAGTGTATCCTTATTCACCACTTGATTTTTCTTT
CCTTTTTAATATATAACTTTCTTTCAAAGACGTGGAAAGA
ATGTAAATTCATTAATGCCCTTTCAACACAGTGAAAGAAA
ATCAGTGAAGTAAACGAAGACAAATCCTTGCAATTCGTGT
TTTTATTTTAATTTACTTTTAAAACATCACCTTTCCATAA
AAAAACAACTGTACATTTATGACTGTGGATTTGCATGCTA
CGTGAACTGTACACTAAAGTTACCCTAAACAATGACAAAA
AAGCTGTTTGCGCTTTAATTTTCTATTAATTTAATTTTTT
TAATCCCGTGCGTACGTTTGTAAATACGAAGTTGCTTTCA
GGCACCTGCAAAGTATAAAAATCATGTGTTATTGCAGACA
GTATACAAATAAAACGCCCCATGTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations