ZFIN ID: ZDB-TSCRIPT-090929-17676
Transcript Name: aak1a-002
Previous Name: si:dkey-71c4.3-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037250 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037250|OTTDARG00000027039|ZDB-GENE-081105-101 aak1a|no_translation DKEY-71C4.3-002 LG_ BX005339.7 Danio rerio protein_coding NOVEL, 534 bp
TCCGGTGCCTTCATCGGACGCGTTTTCTCCATCGGACGCT
ATCAGGTGACCGTGGAGGAGACCGTGGCCGAGGGTGGTTT
TGCTATCGTGTTTCTGGTGAGGACTCATCAGGGCGTGCGC
TGTGCACTGAAGAGAATGTATGTCAACAACGAACACGACC
TTCAAGTATGCAAGATGGAGATTCAGATTATGAGGGACCT
CGTGGGGAACAAAAACATAGTAGGCTTCCTGGACTCCAGC
ATCACAGCGGTGGGATCAGGGGACGTTTGGGAAGTTCTCA
TACTGATGGACTTCTGTAGAGGCGGGCAGGTTGTGAACCT
GATGAACCAGCGTTTGCAGACGGGCTTCAGTGAGTCGGAA
GTGCTGCAGATCTTCTGTGACACATGTGAAGCTGTTGCTC
GACTACATCAGTGCAAACCTCCCATCATCCACCGGGACCT
CAAAGTATGTGCTTTCCAGACTATCAGTATGTAATTTCTT
TCTCAAGAAGGAACTGTTATTGTGTTTTTCAAAATCTATT
TGACTTTAATAAAT

aak1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aak1a-201 (1)    Ensembl 2106
ncRNA aak1a-002 534
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aak1a-002 Contained in:
[BAC] DKEY-71C4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037250 (1),  Ensembl_Trans:ENSDART00000132508 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:AL919482 (1) 539 nt
CITATIONS (2)