Transcript

aak1a-002

ID
ZDB-TSCRIPT-090929-17676
Name
aak1a-002
Previous Names
  • si:dkey-71c4.3-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037250 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037250|OTTDARG00000027039|ZDB-GENE-081105-101 aak1a|no_translation DKEY-71C4.3-002 LG_ BX005339.7 Danio rerio protein_coding NOVEL, 534 bp
TCCGGTGCCTTCATCGGACGCGTTTTCTCCATCGGACGCT
ATCAGGTGACCGTGGAGGAGACCGTGGCCGAGGGTGGTTT
TGCTATCGTGTTTCTGGTGAGGACTCATCAGGGCGTGCGC
TGTGCACTGAAGAGAATGTATGTCAACAACGAACACGACC
TTCAAGTATGCAAGATGGAGATTCAGATTATGAGGGACCT
CGTGGGGAACAAAAACATAGTAGGCTTCCTGGACTCCAGC
ATCACAGCGGTGGGATCAGGGGACGTTTGGGAAGTTCTCA
TACTGATGGACTTCTGTAGAGGCGGGCAGGTTGTGAACCT
GATGAACCAGCGTTTGCAGACGGGCTTCAGTGAGTCGGAA
GTGCTGCAGATCTTCTGTGACACATGTGAAGCTGTTGCTC
GACTACATCAGTGCAAACCTCCCATCATCCACCGGGACCT
CAAAGTATGTGCTTTCCAGACTATCAGTATGTAATTTCTT
TCTCAAGAAGGAACTGTTATTGTGTTTTTCAAAATCTATT
TGACTTTAATAAAT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations