Transcript

aak1a-201

ID
ZDB-TSCRIPT-090929-16687
Name
aak1a-201
Previous Names
  • aak1a-001
  • si:dkey-71c4.3-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036166 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036166|OTTDARG00000027039|ZDB-GENE-081105-101 aak1a|OTTDARP00000029021 DKEY-71C4.3-001 LG_ BX005339.7 Danio rerio protein_coding NOVEL, 2106 bp
ATAATAAACACAGCGTGCCCGGAGGACGACCAGAGAAAGC
GGCTTTTCTGGATTTTTTTCTTCTGACGGGAGCGCGCTGG
CGTTCACCACATCTCCTATTATTATATATCATCATAATCC
ACAGAAGTATGAAGATCTGTCAATGGTGACTCATCCTACA
GCTCTTATATGCGATTTCTTCTCCTCCTCCGAGTTGTTGT
TTTGGATCTCCAGCACTTCATTTAGTCTGTTTTGAGAGTA
TATATTGATATATTAAGAGATTATCTTGCTTTTTTCTGTC
ATTTGTGCTGCTGTCACGCTTGATTGGGATCTGGGAGAAC
GGCGCGTGCACGAGTCCGGCTGATTTATCTGTATTATTTT
CATGGTTTAATGACAATTAAAGTGTCGCCGGTTGGACAAT
GAAGAAGTTCTTCGATGCCCGACGGGAGATGGTGAGCTCC
GGGCCCGCGTCTGGAGCCGGTGCGGGAGGCGGCGCGGGCT
CCGGTGCCTTCATCGGACGCGTTTTCTCCATCGGACGCTA
TCAGGTGACCGTGGAGGAGACCGTGGCCGAGGGTGGTTTT
GCTATCGTGTTTCTGGTGAGGACTCATCAGGGCGTGCGCT
GTGCACTGAAGAGAATGTATGTCAACAACGAACACGACCT
TCAAGTATGCAAGATGGAGATTCAGATTATGAGGGACCTC
GTGGGGAACAAAAACATAGTAGGCTTCCTGGACTCCAGCA
TCACAGCGGTGGGATCAGGGGACGTTTGGGAAGTTCTCAT
ACTGATGGACTTCTGTAGAGGCGGGCAGGTTGTGAACCTG
ATGAACCAGCGTTTGCAGACGGGCTTCAGTGAGTCGGAAG
TGCTGCAGATCTTCTGTGACACATGTGAAGCTGTTGCTCG
ACTACATCAGTGCAAACCTCCCATCATCCACCGGGACCTC
AAAGTGGAGAACATCTTGCTCCATGACAGAGGTCATTATG
TGTTGTGTGATTTCGGTAGTGCCATCAACCGCTCCCAGAA
TCCGCAAACAGAAGGTGTGGCGGTTGTAGAAGAAGAAATC
AAGAAGTACACTACTCTTTCATACCGCGCCCCAGAAATGG
TCAATCTCTACGGAGGCATGGTCATCACTACTAAAGCAGA
TATATGGGCTTTAGGCTGCTTGTTGTATAAGTTGTGTTAT
TTCACATTGCCGTTTGGAGAGAGTCAGGTGGCTATCTGTG
ACGGCAGCTTCACCATCCCAGACAACTCCAGATACTCACA
CGATATGCACTGTCTCATCCGTTACATGCTGGAGCCAGAC
CCTGACATGAGGCCAGATATCTTCCAGGTGTCATATTTCG
CTTTTAAACTCTCCCGGAGGGACTGTCCGGTACAGAACGT
TCACAATTCACCCATTCCAACAAAACTCCCCGAGCCAATC
AGGGCGAGTGAAGCTGTGGCCAAGAAGAGTCAAAACAAAG
CCAGGCTCACTGATCCAGTCCCCACTACTGAGACATCCAT
CGCACCCCGGCAGCGTCCCAAGGCTGGTCAGGCTCAACCA
ATCACAGGCATCCTGCCAATCCAGCCAGCCCTCACTCCTC
GCAAAAGACCCAGTGCACCTCCAGGACCCAGCCAACCAAT
CAGTGTCAACATGGCTTCCCAGCCTCCTGTCGCTCAGCAG
CAAGCCACTCCCTCTCCACCACAGACCACACCCCAGCACG
CACAACTGTTTGTGCAGCAGCAAAATACAGCCTTCTTTAC
TGCTCAACAGCAGTCTGCTGCTGGAAGTCGTGGAGTGCAT
AAAGTCGGCTCTTTGACTCCACCCTCTTCCCCTAAAGCCG
CCCCTAAGGGAGGACACAGAAGAATACTAAGTGATGTCAC
GCACAGCACCATATTTGGAGTTCCTGTGAGCAAATCCACC
CAACTGCTTCAAGCTGCAGCTGCAGAAGCCAGCCTCAACA
AATCAAAGTCGGCTAGCACTACTCCATCGGGGTCTCCGTG
TTCATCACAGCAAAGTGTTTATCAGCCAGCGGATGCTTCT
GGACACTCGGCTGGAGCTACAGGATCCTGGAACCCATTTG
GCGATGACAATTTCTCCAAGCTCACAGCAGAAGAGCTGCT
GAACAAGGATTTTGCCAAACTGGATG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations