ZFIN ID: ZDB-TSCRIPT-090929-16687
Transcript Name: aak1a-201
Previous Names: aak1a-001, si:dkey-71c4.3-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036166 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036166|OTTDARG00000027039|ZDB-GENE-081105-101 aak1a|OTTDARP00000029021 DKEY-71C4.3-001 LG_ BX005339.7 Danio rerio protein_coding NOVEL, 2106 bp
ATAATAAACACAGCGTGCCCGGAGGACGACCAGAGAAAGC
GGCTTTTCTGGATTTTTTTCTTCTGACGGGAGCGCGCTGG
CGTTCACCACATCTCCTATTATTATATATCATCATAATCC
ACAGAAGTATGAAGATCTGTCAATGGTGACTCATCCTACA
GCTCTTATATGCGATTTCTTCTCCTCCTCCGAGTTGTTGT
TTTGGATCTCCAGCACTTCATTTAGTCTGTTTTGAGAGTA
TATATTGATATATTAAGAGATTATCTTGCTTTTTTCTGTC
ATTTGTGCTGCTGTCACGCTTGATTGGGATCTGGGAGAAC
GGCGCGTGCACGAGTCCGGCTGATTTATCTGTATTATTTT
CATGGTTTAATGACAATTAAAGTGTCGCCGGTTGGACAAT
GAAGAAGTTCTTCGATGCCCGACGGGAGATGGTGAGCTCC
GGGCCCGCGTCTGGAGCCGGTGCGGGAGGCGGCGCGGGCT
CCGGTGCCTTCATCGGACGCGTTTTCTCCATCGGACGCTA
TCAGGTGACCGTGGAGGAGACCGTGGCCGAGGGTGGTTTT
GCTATCGTGTTTCTGGTGAGGACTCATCAGGGCGTGCGCT
GTGCACTGAAGAGAATGTATGTCAACAACGAACACGACCT
TCAAGTATGCAAGATGGAGATTCAGATTATGAGGGACCTC
GTGGGGAACAAAAACATAGTAGGCTTCCTGGACTCCAGCA
TCACAGCGGTGGGATCAGGGGACGTTTGGGAAGTTCTCAT
ACTGATGGACTTCTGTAGAGGCGGGCAGGTTGTGAACCTG
ATGAACCAGCGTTTGCAGACGGGCTTCAGTGAGTCGGAAG
TGCTGCAGATCTTCTGTGACACATGTGAAGCTGTTGCTCG
ACTACATCAGTGCAAACCTCCCATCATCCACCGGGACCTC
AAAGTGGAGAACATCTTGCTCCATGACAGAGGTCATTATG
TGTTGTGTGATTTCGGTAGTGCCATCAACCGCTCCCAGAA
TCCGCAAACAGAAGGTGTGGCGGTTGTAGAAGAAGAAATC
AAGAAGTACACTACTCTTTCATACCGCGCCCCAGAAATGG
TCAATCTCTACGGAGGCATGGTCATCACTACTAAAGCAGA
TATATGGGCTTTAGGCTGCTTGTTGTATAAGTTGTGTTAT
TTCACATTGCCGTTTGGAGAGAGTCAGGTGGCTATCTGTG
ACGGCAGCTTCACCATCCCAGACAACTCCAGATACTCACA
CGATATGCACTGTCTCATCCGTTACATGCTGGAGCCAGAC
CCTGACATGAGGCCAGATATCTTCCAGGTGTCATATTTCG
CTTTTAAACTCTCCCGGAGGGACTGTCCGGTACAGAACGT
TCACAATTCACCCATTCCAACAAAACTCCCCGAGCCAATC
AGGGCGAGTGAAGCTGTGGCCAAGAAGAGTCAAAACAAAG
CCAGGCTCACTGATCCAGTCCCCACTACTGAGACATCCAT
CGCACCCCGGCAGCGTCCCAAGGCTGGTCAGGCTCAACCA
ATCACAGGCATCCTGCCAATCCAGCCAGCCCTCACTCCTC
GCAAAAGACCCAGTGCACCTCCAGGACCCAGCCAACCAAT
CAGTGTCAACATGGCTTCCCAGCCTCCTGTCGCTCAGCAG
CAAGCCACTCCCTCTCCACCACAGACCACACCCCAGCACG
CACAACTGTTTGTGCAGCAGCAAAATACAGCCTTCTTTAC
TGCTCAACAGCAGTCTGCTGCTGGAAGTCGTGGAGTGCAT
AAAGTCGGCTCTTTGACTCCACCCTCTTCCCCTAAAGCCG
CCCCTAAGGGAGGACACAGAAGAATACTAAGTGATGTCAC
GCACAGCACCATATTTGGAGTTCCTGTGAGCAAATCCACC
CAACTGCTTCAAGCTGCAGCTGCAGAAGCCAGCCTCAACA
AATCAAAGTCGGCTAGCACTACTCCATCGGGGTCTCCGTG
TTCATCACAGCAAAGTGTTTATCAGCCAGCGGATGCTTCT
GGACACTCGGCTGGAGCTACAGGATCCTGGAACCCATTTG
GCGATGACAATTTCTCCAAGCTCACAGCAGAAGAGCTGCT
GAACAAGGATTTTGCCAAACTGGATG

aak1a TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA aak1a-201 2106
ncRNA aak1a-002 (1)    Ensembl 534
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
aak1a-201 Contained in:
[BAC] DKEY-71C4 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036166 (1),  Ensembl_Trans:ENSDART00000008058 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CT672128 (1) 869 nt
GenBank:BM140979 (1) 630 nt
CITATIONS (2)