ZFIN ID: ZDB-TSCRIPT-090929-17639
Transcript Name: dhodh-201
Previous Name: dhodh-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037213 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037213|OTTDARG00000027600|ZDB-GENE-030131-3157 dhodh|OTTDARP00000029823 DKEY-90B24.1-001 LG_ CR382281.9 Danio rerio protein_coding KNOWN, 1562 bp
GATGTTGTTCTCGCGAGAGTTCGTTCAGGAAGTGAAAAAC
GAAGCGCTGCATGTTGTTTGGATAGAGTTGGATAACAACA
CACATGGCGGGACGGCTGAAGAAACAGGCGAAAGATGCTG
TAAAGATCATAGGATGTGGCAGTGCACTGTTCCTGGGATA
CCTCACAGCCTCAGGGGATGAGTGTTTTTATGCCAGTGCA
CTCATGCCAGTTCTGCAGAGGTTTGTGGGAGGAGAGACGG
CTCATCTCATGGCTGTCCGATTGATTGGTCTTGGACTTGT
GCCTCGCAACAACTATAAGGACCCGACCTCACTGGAAGTG
CATGTGATGGGTCGTAAGTTCCAGAACCCAGTTGGTATGG
CAGCAGGCTTTGACAAGCACGGTGAGGCAGTGGATGGCCT
CTATAGACTTGGCTTTGGTTTCGTGGAGGTGGGAACTGTC
ACACCAAAACCACAGGATGGAAACCCAAAACCACGTGTGT
TCAGACTGGAGTCAGACCAGGCTATTATTAACAGATATGG
ATTCAACAGTTGTGGCCTTTCTGCAGTACATGAAAGGTTA
AAAGCCAGAGAGCATGTTCAATCAGAGCTAACAAAAGCAG
GCAAACCTCTTGGCATCAATCTTGGAAAGAACAAGCTTTC
GCCAGATGCAGTGTCGGATTATGTGGAAGGAGTACGGACA
CTGGGTCCTCTTGCTGACTACCTTGTAGTAAACGTGAGCA
GCCCCAACACTCCTGGCCTTCGAGATCTACAGGGCAAGGA
AGAACTGCGCCACCTTCTGGACAAGGTGGTTAAAGAGCGT
GATTCATTGCGAATCGAGAATCGACCGCCGGTGCTGGTGA
AAATTGCCCCAGATCTTACTATACAGGACAAGCAAGACAT
AGCTGAGGTCATCATGGAGGTTGGTGTTGATGGTGTAATG
GTTTCCAACACCACTGTTTCCAGGCCAGACACTCTAAAAG
ACCCCAATAGAGTTGAGACTGGGGGACTCAGTGGTCAACC
TCTTAAAGAGCTTTCCACTCAGACAGTGCGAGAGATGTAC
ACATTAACACAAGGGAAGCTGCCAATTGTTGGAGTGGGAG
GAGTGGCCAGCGGTCAGGATGCCATGGATAAGATCCGTGC
GGGAGCTTCTCTGGTGCAGCTGTACACAGCTCTAGTCTAC
CAGGGGCCGCCGGTGGTCAACAAGATCAAAAGAGAACTGG
ATGATCTTCTGAAGGCACAAGGTTTTACATGTGTTGCTGA
AGCAGTAGGTGCTGATCATAAAACCACAGAGAAAATGGCG
ACAACCACATCAGATGTGACTCCATAATGCTTAAGAATTA
GTATTCACTGTTGGACATGATTGATCTTATTTCAAGTCTT
TCAACTATTGATTCAAGAAAAGCTGGAACAATAAAATGAA
TCATGCTATAGCCATGCTATGGTGATATGAAGATACGCCA
TGCTGTTGTTATAAATTAATATTTGTATGTAAAAATGCAT
CCACACGAGTGGTTGACGTGATACTTTATATTCCTGTGTT
TAAAGGAATATATGAATTTGAATAAAGTGCACTGCTTTGT
AA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dhodh-201 Contained in:
[BAC] DKEY-90B24 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000037213 (1),  Ensembl_Trans:ENSDART00000073597 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC086819 (1) 1584 nt
CITATIONS (2)