header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17571
Transcript Name: dph2-003
Previous Name: zgc:162269-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037140 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037140|OTTDARG00000027571|ZDB-GENE-030219-100 dph2|no_translation DKEY-86L18.2-003 LG_ CT574559.10 Danio rerio protein_coding KNOWN, 597 bp
GACATGTAATTTGCAGCTCTGTTTTGTGAGAGAAGATGAC
GGACGCGTTCAGCAGCAGCAGTGAGGCGGTTCTCCAGCGC
TCGGTCACTTCAACACACAGTTTCCACCCTTCTGGAGACC
TTCTGCTGCTCTACCAGACACCCGAGACCTGTCGTTTCAT
CACTAGCAATCACTTCAAGAAGGTGGCCTTACAGTTTCCA
GATGAACTGCTGCCTGATGCCGTCCGGGTATCTGCTGAAA
TAGAGGATAAAACCAAAGCCAAGACTTACATTTTAGGGGA
TACATCCTATGGCAGCTGTTGTGTGGATGAAGTAGCAGCA
GAACATGTGGGAGCAGACTGTATAGTGCATTATGGGTCAT
CTTGTCTCAGCCCATGCAGACGACTACCGCTTCTGTACGT
GTTTGGGAAAAGACCCATTGATGTCCATCAGTGTGCGTCA
TCCTTTAAAGAGCTTTACCCGAATCTCCAAAGCCATATCA
TAGTACTGTTTGACGTCACTTACTCACATGCTATAGGTAA
TATTCACCATTCAATCCGTCCTAATGTTTAGTGACATTCA
TTGTAACCGATAATTCACCCCAAAATGAGATTGTCAT

dph2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dph2-003 597
mRNA dph2-201 (1) 2778
dph2-203 (1) 935
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dph2-003 Contained in:
OTHER dph2-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037140 (1)
  • Ensembl_Trans:ENSDART00000136739 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:EV605995 (1) 597bp
    CITATIONS (2)