header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17569
Transcript Name: dph2-201
Previous Names: dph2-001, zgc:162269-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037138 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037138|OTTDARG00000027571|ZDB-GENE-030219-100 dph2|OTTDARP00000029776 DKEY-86L18.2-001 LG_ CT574559.10 Danio rerio protein_coding KNOWN, 1941 bp
GAAGAGCGTGTCCTGTTCCGGAACCTCACGTGGGAGTTGA
CATGTAATTTGCAGCTCTGTTTTGTGAGAGAAGATGACGG
ACGCGTTCAGCAGCAGCAGTGAGGCGGTTCTCCAGCGCTC
GGTCACTTCAACACACAGTTTCCACCCTTCTGGAGACCTT
CTGCTGCTCTACCAGACACCCGAGACCTGTCGTTTCATCA
CTAGCAATCACTTCAAGAAGGTGGCCTTACAGTTTCCAGA
TGAACTGCTGCCTGATGCCGTCCGGGTATCTGCTGAAATA
GAGGATAAAACCAAAGCCAAGACTTACATTTTAGGGGATA
CATCCTATGGCAGCTGTTGTGTGGATGAAGTAGCAGCAGA
ACATGTGGGAGCAGACTGTATAGTGCATTATGGGTCATCT
TGTCTCAGCCCATGCAGACGACTACCGCTTCTGTACGTGT
TTGGGAAAAGACCCATTGATGTCCATCAGTGTGCGTCATC
CTTTAAAGAGCTTTACCCGAATCTCCAAAGCCATATCATA
GTACTGTTTGACGTCACTTACTCACATGCTATAGATGATC
TCAGAACACTTTTGTGTGACGTCTACCCTAATGTTGTGGT
GTCTCGTCTGAAAACGGATCATTCCTGTGGTGCTGAACTC
ATACAGGACAGCTGTGTGGACTTGCAGTCAAACGATGATG
GAGTCATTTTTAAATTTGGCAGACAATTCAGAATAAAAGA
AGGACAAACTGTTAATGATTACAGCATCTTTTACATTGGC
CAGGAAGGCCTGACGCTTACAAACTTCATGATGAGCTGGA
ACAATTGTGTCTTTAGCTCATTCAACCCAGAGACAAGCAC
GGGTCGAGTGGAATCGGTTCAAATCAACAAAGCACTGATG
AAGCGCTATTATGCCATTGAGCGGGCCAAAGATGCCAGTG
TGGTGGGCATTTTGGTGGGCACCCTGGGTGTTGCCAACTA
TCTGATTATCATCGAACAGCTGAAAGACACTATTCAAAGA
GCAGGCAAGAAGAGCTATATGTTTGCCATGGGAAAGATCA
ATGTTCCCAAGCTTGCGAACTTCCTGGAAATTGATATTTA
CGTGTTAGTTGCGTGTCCAGAAAACTCCCTGCTGGACTCA
AGTGAATTCTACAGGCCTGTGGTGACTCCGTTTGAGATGG
AGCTGGCTTGTAATAAGCACAGAGAGTGGACTGGAGAATA
TGTCACAGACTTCAGAGAGTTACTGCCTGGTGGAAGCAGT
CATGTGGGCTTTCCTGAACCCAGTCAGTCTGCCACTGAGG
AGGAGACCACAGACGTGTCTCTCATCACAGGAGCTCTACG
AAGCTGTTCCACCAACTCATCTGAGATGATGCATAACTCA
GAGACATCTTCGCTTGTCCTCAGGAATCAGACTCTCACTG
TGGCCAATACTAACGCTGCGGCATCTTTTCTGGCAGGCCG
CAGCTGGCAGGGACTGGAGCCAAAATTAGGGCAGACCCCG
GTGGTTAAAGCTGTAAAGGGACAGAGAGGCATTGCAATCG
CTTACGAAGAGGAGGGTAATGAGGACGCTTCAACACAACA
AAAATTATAACACTCGTTTACTGTTGGACAGTCACAGGAA
TCATCAAAAGATTACTTTACATGTATTGATATAGTAATAA
AACATCTATTGGGGGCATGTTTTATATTCCCTTGATAAGG
CCAAGTACTTACTGCTCTAAAAACATGAATCAAGGTAAAT
AAATATCTTCTTTTTTGTGCTATATTATACCAATATGGTA
GCCAAACTGTGGAGCAATTAAGCAATTAAATGAGAAAAAT
ATAAACGTGATCTTGTTTGTAATGAAGACAAAAGATTGAG
CTTTATACTTTGAAGTCATCAAAAACATGTTATGAGGTAC
TGTACAGCAGCAAATCTCTAGTGTAAATGTAGTAACAATA
AAGGGAAAGTTCTACCTAGAA

dph2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA dph2-003 (1) 597
mRNA dph2-201 2778
dph2-203 (1) 935
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
dph2-201 Contained in:
OTHER dph2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037138 (1)
  • Ensembl_Trans:ENSDART00000114076 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC134939 (1) 1946bp
    GenBank:EE206448 (1) 469bp
    CITATIONS (2)