header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17544
Transcript Name: mtmr10-202
Previous Names: mtmr10-002, zgc:153233-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037113 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037113|OTTDARG00000027552|ZDB-GENE-061103-52 mtmr10|OTTDARP00000029753 CH211-214O7.3-002 LG_ BX663518.10 Danio rerio protein_coding KNOWN, 2298 bp
ATGTTCTCCGGTAAACAAACCAAGCCGACTTTCAAGTCTT
ATCTTCCTCCACTTCAGACCGATTTGAAGAAAAGTCCACA
ACTGCCTATCAAGAAGCTAGAAGCAAAACTTTTACCGGGT
GAAATAGTTGTGAACGAGGCGAACTTTGTAAGAAAGTGCA
TCGGTGCAGACAGTGGTCAGGATGACCTTTGGGGCAAACT
TGTGTGTACCAACTTCAAGGTCTCCTTCATTTCCCATAAT
TCATTGCCACAGCAGAGATTTCAGTGTACCCACCGGCTTC
TGGGTGAGCATGATATCCCGCTGGCTTGTGTGGAGCAGGT
AGTAACAGTGAATGATGTTAAAGGGAAGCAGAAGATCTTA
GGATCCAACCAGAAGCTGAAATTTAACCCTACTGAGCTTA
TTCTCTACTGCAAAGACTTCCGGATCATCCGATTCCGCTT
TGATGAAGCTGGACCTGAGAGCGCTAAAAAGGTATGTCTG
GCCATCGCTCATTACTCCCATCCTGCTGACCCACAGCTAC
TCTTTGGCTTTGAATACGTCGGAAAGCGATATCATGGATC
AGCGGGTGAGCGGGTGAATGGTGTTGACCCTGGCGGGGGT
TTGCAGACTCCCCTGTTTGACTGTTCTTCAGATTGGGACA
GGGAGATCAAGCGTACCGGTGCCTCTGAATGGAGGGTGTG
TACCATCAATCAAGGCTATTTCATCTCACCCAGTCTACCT
GAGTTCTTTGTGGTTCCGGTCTCTCTAGCGGATCAGGATC
TGAAGCAGTACGCCTGCTGCTTTTACTCGCAGCGCATCCC
GTTGTGGTGCTGGAATCACCCCTGTGGAAGTGCTCTGGTT
CGCATGTCTAACATCAGTGACCCGCAACAACAGAGAAAAG
TGGAGCAGAGGATTTCCAGTGCCATCACTAAGAGCCACCC
ACTGCGCAGTGATGTCTTCAAGTCGGATTTAGACAAAAAC
CTCCCCAACATCCAGGATATTCAAGCTGCTCTTCTTAAAC
TGCGACAGATCTGCGTTATAGAGTCATTTGAGGAGTCTGA
AGAGAAATGGCTGTCATCCTTAGAGAGTTCAAGATGGATG
GAGTACGTCAGGACATTTTTGCGGCACGCAGTGGAGGTAG
TCTATATGCTTGAGAGCAGGCATGTGTCTGTCATACTCCT
TGAGAAGGAGGACCGGGACCTGAGCTGTGTGATTTCCAGT
CTGGTGCAGCTGATGTGTGATCCACACTGCAGGAGTCTGC
ATGGCTTCCAGGCTCTGATTCAAAAGGAGTGGGTGATGGC
TGGGCATCGTTTCCTGGATCGCTGCAACCATCTGAAGAAG
AGTGATAAAGAGGAGTCTCCTTTGTTTCTGCTGTTCCTGG
ACTGTGTGTGGCAGCTGTGGAATCAGTATCCAGCAGCGTT
TGAGTTCACTGAGGTCTACCTGACGGTGTTGGGGGACAGT
ATGTGGGTCCCTGTTTTCAGCACCTTCCTCTTTAACTGCC
CGCGACAAAGAGCAGAGCACAGCAGGGATTTTGCAAGCAG
TAAAAGTATTCACCTGGGGCAGGACCAGGCTCTGCGTTTT
CCTCCAGTGTGGGACTGGTCTCAACAGTTCAGCCTCAAAG
ACCAGACTCTTTTTAATAATCCCCTGTACGTGGGCAAGAT
CGCCACCTGTTTGCAGAACGGCACAGTGAAGACCTTCACA
CACAGGCGCAGCAAGAAAAACTACAGTTCCACTGTGCGCG
GTTTGCCTTCACTCATGCGCAATGGATCTCTTGGGCCGAA
CGACACCCTGACCCGCCGAAACTCTCTTGTGCTGCGTCTG
CGTTCTGACTTGTCTCAGGTGCGGGAGCAGCCGGAGACTC
CGTCAGAGCGCTTCGTTCGGGACTTCTTTTCTCGGGCTGT
CGATCTGCAAGGCCTGCTGCTCCCCCAGCTCCTCCCATCT
CACCTCTCCGTCTGGAAGCTGTACTTCCTACGCTGGGTCC
CCGAGGCCCAGATCCCACACGGCGGGCCTGTCACTGCCTT
CCACAAGCTCTCAGTGCTCACAGACGAGATCGAAATGCTC
CAGAATCAGCTGAGGCAGTACAAAGGAGCAGCCGGGACTG
CTAACACATCCCACGCGGAGCACAGCAAAATGTACTTTAA
GGCCACTTCCACTCCTCAGCAGTGCCCTGCTCCTCCAGAA
TACCTCAGCTCCTCGTTTCCCTTCTCTCCTGTGGGCAATC
TGTGTCGGCCCGGCATTTTGGGGACTCCTCTGAGCAAGTT
TCTCAACGGGGCCAAGATCTGGCTCTCTACAGAGACGCTG
GCCAATGAGACCATCTGA

mtmr10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mtmr10-201 (1)    Ensembl 5301
mtmr10-202 2298
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mtmr10-202 Contained in:

Genome Resources: Vega_Trans:OTTDART00000037113 (1),  Ensembl_Trans:ENSDART00000127131 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES No data available
CITATIONS (2)