Transcript

mtmr10-202

ID
ZDB-TSCRIPT-090929-17544
Name
mtmr10-202
Previous Names
  • mtmr10-002
  • zgc:153233-002
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000037113 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000037113|OTTDARG00000027552|ZDB-GENE-061103-52 mtmr10|OTTDARP00000029753 CH211-214O7.3-002 LG_ BX663518.10 Danio rerio protein_coding KNOWN, 2298 bp
ATGTTCTCCGGTAAACAAACCAAGCCGACTTTCAAGTCTT
ATCTTCCTCCACTTCAGACCGATTTGAAGAAAAGTCCACA
ACTGCCTATCAAGAAGCTAGAAGCAAAACTTTTACCGGGT
GAAATAGTTGTGAACGAGGCGAACTTTGTAAGAAAGTGCA
TCGGTGCAGACAGTGGTCAGGATGACCTTTGGGGCAAACT
TGTGTGTACCAACTTCAAGGTCTCCTTCATTTCCCATAAT
TCATTGCCACAGCAGAGATTTCAGTGTACCCACCGGCTTC
TGGGTGAGCATGATATCCCGCTGGCTTGTGTGGAGCAGGT
AGTAACAGTGAATGATGTTAAAGGGAAGCAGAAGATCTTA
GGATCCAACCAGAAGCTGAAATTTAACCCTACTGAGCTTA
TTCTCTACTGCAAAGACTTCCGGATCATCCGATTCCGCTT
TGATGAAGCTGGACCTGAGAGCGCTAAAAAGGTATGTCTG
GCCATCGCTCATTACTCCCATCCTGCTGACCCACAGCTAC
TCTTTGGCTTTGAATACGTCGGAAAGCGATATCATGGATC
AGCGGGTGAGCGGGTGAATGGTGTTGACCCTGGCGGGGGT
TTGCAGACTCCCCTGTTTGACTGTTCTTCAGATTGGGACA
GGGAGATCAAGCGTACCGGTGCCTCTGAATGGAGGGTGTG
TACCATCAATCAAGGCTATTTCATCTCACCCAGTCTACCT
GAGTTCTTTGTGGTTCCGGTCTCTCTAGCGGATCAGGATC
TGAAGCAGTACGCCTGCTGCTTTTACTCGCAGCGCATCCC
GTTGTGGTGCTGGAATCACCCCTGTGGAAGTGCTCTGGTT
CGCATGTCTAACATCAGTGACCCGCAACAACAGAGAAAAG
TGGAGCAGAGGATTTCCAGTGCCATCACTAAGAGCCACCC
ACTGCGCAGTGATGTCTTCAAGTCGGATTTAGACAAAAAC
CTCCCCAACATCCAGGATATTCAAGCTGCTCTTCTTAAAC
TGCGACAGATCTGCGTTATAGAGTCATTTGAGGAGTCTGA
AGAGAAATGGCTGTCATCCTTAGAGAGTTCAAGATGGATG
GAGTACGTCAGGACATTTTTGCGGCACGCAGTGGAGGTAG
TCTATATGCTTGAGAGCAGGCATGTGTCTGTCATACTCCT
TGAGAAGGAGGACCGGGACCTGAGCTGTGTGATTTCCAGT
CTGGTGCAGCTGATGTGTGATCCACACTGCAGGAGTCTGC
ATGGCTTCCAGGCTCTGATTCAAAAGGAGTGGGTGATGGC
TGGGCATCGTTTCCTGGATCGCTGCAACCATCTGAAGAAG
AGTGATAAAGAGGAGTCTCCTTTGTTTCTGCTGTTCCTGG
ACTGTGTGTGGCAGCTGTGGAATCAGTATCCAGCAGCGTT
TGAGTTCACTGAGGTCTACCTGACGGTGTTGGGGGACAGT
ATGTGGGTCCCTGTTTTCAGCACCTTCCTCTTTAACTGCC
CGCGACAAAGAGCAGAGCACAGCAGGGATTTTGCAAGCAG
TAAAAGTATTCACCTGGGGCAGGACCAGGCTCTGCGTTTT
CCTCCAGTGTGGGACTGGTCTCAACAGTTCAGCCTCAAAG
ACCAGACTCTTTTTAATAATCCCCTGTACGTGGGCAAGAT
CGCCACCTGTTTGCAGAACGGCACAGTGAAGACCTTCACA
CACAGGCGCAGCAAGAAAAACTACAGTTCCACTGTGCGCG
GTTTGCCTTCACTCATGCGCAATGGATCTCTTGGGCCGAA
CGACACCCTGACCCGCCGAAACTCTCTTGTGCTGCGTCTG
CGTTCTGACTTGTCTCAGGTGCGGGAGCAGCCGGAGACTC
CGTCAGAGCGCTTCGTTCGGGACTTCTTTTCTCGGGCTGT
CGATCTGCAAGGCCTGCTGCTCCCCCAGCTCCTCCCATCT
CACCTCTCCGTCTGGAAGCTGTACTTCCTACGCTGGGTCC
CCGAGGCCCAGATCCCACACGGCGGGCCTGTCACTGCCTT
CCACAAGCTCTCAGTGCTCACAGACGAGATCGAAATGCTC
CAGAATCAGCTGAGGCAGTACAAAGGAGCAGCCGGGACTG
CTAACACATCCCACGCGGAGCACAGCAAAATGTACTTTAA
GGCCACTTCCACTCCTCAGCAGTGCCCTGCTCCTCCAGAA
TACCTCAGCTCCTCGTTTCCCTTCTCTCCTGTGGGCAATC
TGTGTCGGCCCGGCATTTTGGGGACTCCTCTGAGCAAGTT
TCTCAACGGGGCCAAGATCTGGCTCTCTACAGAGACGCTG
GCCAATGAGACCATCTGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations