ZFIN ID: ZDB-TSCRIPT-090929-17543
Transcript Name: mtmr10-201
Previous Names: mtmr10-001, zgc:153233-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037112 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037112|OTTDARG00000027552|ZDB-GENE-061103-52 mtmr10|OTTDARP00000029752 CH211-214O7.3-001 LG_ BX663518.10 Danio rerio protein_coding KNOWN, 2699 bp
TATACGGGGAAACTAAAGCAGCAAAAAGTTTGACAGCCGC
CAACGAAGAGAGACTTCAGCGGGACAGACAGAGACTGAGC
TCAGATACTACTGCACACTGAGCAGATACTAAATACTGCT
TTTGCATTTATGGAAATTATTCTTTAAACGCCTCTTCTAC
TGAAGAAACCGTGGATTTGTGGCTCTGAGCTAGCACAAAA
CAGTTTTGGTTTACGTTTTAAGATTCTTAAGCTGCTCTTG
TATGGATTTACTATTCGCATTTTTGTTGTATCGGCTCGTG
TAAACGATGTTCTCCGGTAAACAAACCAAGCCGACTTTCA
AGTCTTATCTTCCTCCACTTCAGACCGATTTGAAGAAAAG
TCCACAACTGCCTATCAAGAAGCTAGAAGCAAAACTTTTA
CCGGGTGAAATAGTTGTGAACGAGGCGAACTTTGTAAGAA
AGTGCATCGGTGCAGACAGTGGTCAGGATGACCTTTGGGG
CAAACTTGTGTGTACCAACTTCAAGGTCTCCTTCATTTCC
CATAATTCATTGCCACAGCAGAGATTTCAGTGTACCCACC
GGCTTCTGGGTGAGCATGATATCCCGCTGGCTTGTGTGGA
GCAGGTAGTAACAGTGAATGATGTTAAAGGGAAGCAGAAG
ATCTTAGGATCCAACCAGAAGCTGAAATTTAACCCTACTG
AGCTTATTCTCTACTGCAAAGACTTCCGGATCATCCGATT
CCGCTTTGATGAAGCTGGACCTGAGAGCGCTAAAAAGGTA
TGTCTGGCCATCGCTCATTACTCCCATCCTGCTGACCCAC
AGCTACTCTTTGGCTTTGAATACGTCGGAAAGCGATATCA
TGGATCAGCGGGTGAGCGGGTGAATGGTGTTGACCCTGGC
GGGGGTTTGCAGACTCCCCTGTTTGACTGTTCTTCAGATT
GGGACAGGGAGATCAAGCGTACCGGTGCCTCTGAATGGAG
GGTGTGTACCATCAATCAAGGCTATTTCATCTCACCCAGT
CTACCTGAGTTCTTTGTGGTTCCGGTCTCTCTAGCGGATC
AGGATCTGAAGCAGTACGCCTGCTGCTTTTACTCGCAGCG
CATCCCGTTGTGGTGCTGGAATCACCCCTGTGGAAGTGCT
CTGGTTCGCATGTCTAACATCAGTGACCCGCAACAACAGA
GAAAAGTGGAGCAGAGGATTTCCAGTGCCATCACTAAGAG
CCACCCACTGCGCAGTGATGTCTTCAAGTCGGATTTAGAC
AAAAACCTCCCCAACATCCAGGATATTCAAGCTGCTCTTC
TTAAACTGCGACAGATCTGCGTTATAGAGTCATTTGAGGA
GTCTGAAGAGAAATGGCTGTCATCCTTAGAGAGTTCAAGA
TGGATGGAGTACGTCAGGACATTTTTGCGGCACGCAGTGG
AGGTAGTCTATATGCTTGAGAGCAGGCATGTGTCTGTCAT
ACTCCTTGAGAAGGAGGACCGGGACCTGAGCTGTGTGATT
TCCAGTCTGGTGCAGCTGATGTGTGATCCACACTGCAGGA
GTCTGCATGGCTTCCAGGCTCTGATTCAAAAGGAGTGGGT
GATGGCTGGGCATCGTTTCCTGGATCGCTGCAACCATCTG
AAGAAGAGTGATAAAGAGGAGCTGTGGAATCAGTATCCAG
CAGCGTTTGAGTTCACTGAGGTCTACCTGACGGTGTTGGG
GGACAGTATGTGGGTCCCTGTTTTCAGCACCTTCCTCTTT
AACTGCCCGCGACAAAGAGCAGAGCACAGCAGGGATTTTG
CAAGCAGTAAAAGTATTCACCTGGGGCAGGACCAGGCTCT
GCGTTTTCCTCCAGTGTGGGACTGGTCTCAACAGTTCAGC
CTCAAAGACCAGACTCTTTTTAATAATCCCCTGTACGTGG
GCAAGATCGCCACCTGTTTGCAGAACGGCACAGTGAAGAC
CTTCACACACAGGCGCAGCAAGAAAAACTACAGTTCCACT
GTGCGCGGTTTGCCTTCACTCATGCGCAATGGATCTCTTG
GGCCGAACGACACCCTGACCCGCCGAAACTCTCTTGTGCT
GCGTCTGCGTTCTGACTTGTCTCAGGTGCGGGAGCAGCCG
GAGACTCCGTCAGAGCGCTTCGTTCGGGACTTCTTTTCTC
GGGCTGTCGATCTGCAAGGCCTGCTGCTCCCCCAGCTCCT
CCCATCTCACCTCTCCGTCTGGAAGCTGTACTTCCTACGC
TGGGTCCCCGAGGCCCAGATCCCACACGGCGGGCCTGTCA
CTGCCTTCCACAAGCTCTCAGTGCTCACAGACGAGATCGA
AATGCTCCAGAATCAGCTGAGGCAGTACAAAGGAGCAGCC
GGGACTGCTAACACATCCCACGCGGAGCACAGCAAAATGT
ACTTTAAGGCCACTTCCACTCCTCAGCAGTGCCCTGCTCC
TCCAGAATACCTCAGCTCCTCGTTTCCCTTCTCTCCTGTG
GGCAATCTGTGTCGGCCCGGCATTTTGGGGACTCCTCTGA
GCAAGTTTCTCAACGGGGCCAAGATCTGGCTCTCTACAGA
GACGCTGGCCAATGAGACCATCTGAAAGTGGATCAACATG
AAGATCTTGCGTGATGTGAATGTGCAGGCTTGTGGTACGG
ACACGTTTTTATTCAGTCTGTTGAGAGCCGTCGGCTGGTG
AGGTTTTTTTAATTTTTTTTTTATTCTTGCACATGATTAA
ATATAATGCTCCAATCGCA

mtmr10 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA mtmr10-201 5301
mtmr10-202 (1)    Ensembl 2298
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
mtmr10-201 Contained in:
[BAC] CH211-214O7 (1)

Genome Resources: Vega_Trans:OTTDART00000037112 (1),  Ensembl_Trans:ENSDART00000085716 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC125860 (1) 2732 bp
GenBank:CV485931 (1) 827 bp
CITATIONS (2)