header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17445
Transcript Name: nup37-003
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000037007 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000037007|OTTDARG00000008008|ZDB-GENE-040718-363 nup37|no_translation CH211-260P3.1-003 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 446 bp
GAACTCCTCCACAATAAATCACCTTACGACATTAACATGA
GCAGTTTTGCTAGCTAAATCCATGACATAATACAGGAGTG
AATTAAACTGTCTGTAAATGATGTGTTTTGCCTGCAGTTA
TCCACTCGAGAAAAGACCCGCACATGTTGACAAGGCGAGA
CATTTCAGATGGTCAAGGGCAAATGAGAATCTTTTTGCTA
CCACAGGCTACCCAGGAAAAATCAACAGTCAGTTACTGGT
GCATCATCTTGGCCATCCACAGCCTGTCATGCTTGGTTCG
GCATCTGTGGGGGCTGGACTGAGCTGGCACAGGACCCTGC
CTCTTTGTGTTATTGGTGGGGATCGAAAGTTGTTCTTCTG
GATGACGGAGATGTAAATTGGTTCGAAGTCAACTGGAGAG
TCTTTCTGTTTTCCTTTTTCAGTAAATAAAGTCATATTTT
TCATGC

nup37 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA nup37-003 446
nup37-004 (1) 593
mRNA nup37-202 (1) 1479
nup37-204 (1) 1006
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nup37-003 Contained in:

OTHER nup37-003 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000037007 (1)
  • Ensembl_Trans:ENSDART00000141050 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN169493 (1) 517 bp
    GenBank:EH509251 (1) 473 bp
    GenBank:EH535359 (1) 456 bp
    CITATIONS (2)