header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1390
Transcript Name: nup37-202
Previous Name: nup37-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000009115 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000009115|OTTDARG00000008008|ZDB-GENE-040718-363 nup37|OTTDARP00000007855 CH211-260P3.1-001 LG_ BX510924.11 Danio rerio protein_coding KNOWN, 1479 bp
TTTCTCTTTTTTTTTTTTTTTTTGACGAACCACGTTGTCA
ACCAATATTGGCTCTTTTGTTCACGTGCATAGAGCTGTCG
AAGTTACAGTAAACACCACTTGGTGGCGCTCAAATACTAA
TGACGAAGATGCAAGATGATAGTGGAGCTGCTCATTTAAT
TGGTGTCTGACACAACGTTTTTGTGTGATAAACGTGATAG
TGACTGCAAAGTGTCTGGTTAATATGGAGAGGAGTTCCAG
GTCAAATAGAATTCGATGGTGAGTAAATTTTTCCACTTAA
TATTATTTCATGGCATGTAAGTTAATGAAATACCATCCAA
AGTCAGGAAGTGATTTTCGAAAATCGCCGACGATAAGCTT
GAGCGAAAACCGTCCCGGTTAGGCAAACCCATTTCTTCTC
AACAATAAAGATCAATTTGATGGAAGATGCCAGATGATAC
AGTCCGCTCTGCAAGCTACACAGTGCCCTGCGAGGACTAT
GTCCACGTAGTGGAGTTCAGTCCATATGATTGTGGCTCAC
CTGCGTCACTCTTGGCATACGGAGGAAACAAGTATGTGGT
CGTCGGCACTTGTCGTTTTAAGGAGGAAGACGCAGAGGTG
GAGGGTGTAGAGTTTAACTCATTACAGGTGTTCATGCATG
GAGTACGCGTGGATGCCATCGCATGGAGCCCTGAAACCCA
TCTAGACAAGCTCCCTCCAGTCATCAGGTTTTCCACTGCA
GCAGCTGACAGAAAAATCAGGCTGTGGACATCGGATCTCC
AAAACAGTTGTGATGTGAAGGTGATGGAAGGCCACACCAG
CTACATCAATCATTTAGTGTTTGAACCTGCAGAAGGAAAG
CAAATAGCCTCTGTCAGCGATGACCACACTTGCAGAGTTT
GGGACCTTGATGGTAATGAAACCACCTCATTCAGGCTTCG
TTCCCCTGGTGTAAGTGTCTGTTGGCACCCTGAAGACAAC
TGTAAGTTGATGGTGGCAGAGAAGAAGGGCACAATACGGT
TCTATGACCTTGTCACACAGCATGCCATTCTGTCACTGGA
CAGCGGGCAGGTGCCACTCATGTCAGCTGACTGGTGTCTC
ACAAACACTATAAAGGTTGGAGCTGTGGTGGCCAATGATT
GGGTTATCTGGGACATTACACGGTCCAGTTATCCACTCGA
GAAAAGACCCGCACATGTTGACAAGGCGAGACATTTCAGA
TGGTCAAGGGCAAATGAGAATCTTTTTGCTACCACAGGCT
ACCCAGGAAAAATCAACAGTCAGTTACTGGTGCATCATCT
TGGCCATCCACAGCCTGTCATGCTTGGTTCGGCATCTGTG
GGGGCTGGACTGAGCTGGCACAGGACCCTGCCTCTTTGTG
TTATTGGTGGGGATCGAAAGTTGTTCTTCTGGATGACGGA
GATGTAAATTGGTTCGAAGTCAACTGGAGAGTCTTTCTGT
TTTCCTTTTTCAGTAAATAAAGTCATATTTTTCATGCGC

nup37 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA nup37-003 (1) 446
nup37-004 (1) 593
mRNA nup37-202 1479
nup37-204 (1) 1006
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nup37-202 Contained in:

OTHER nup37-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000009115 (1)
  • Ensembl_Trans:ENSDART00000133160 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC075968 (1) 1494 bp
    GenBank:EH564314 (1) 953 bp
    GenBank:EG585959 (1) 909 bp
    GenBank:EH565137 (1) 850 bp
    GenBank:CK029886 (1) 724 bp
    GenBank:CT723469 (1) 723 bp
    GenBank:BI709620 (1) 599 bp
    CITATIONS (2)