Transcript

plag1-201

ID
ZDB-TSCRIPT-090929-17347
Name
plag1-201
Previous Names
  • plag1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036902 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036902|OTTDARG00000027438|ZDB-GENE-060302-2 plag1|OTTDARP00000029584 plag1-001 LG_ CR407553.6 Danio rerio protein_coding KNOWN, 2734 bp
GGAAAGAGGGGAAAGCAAACAATTTTTAGGCCCGCCGCGT
CCAGCAAAAAATATGAGAAAAAAATTATTAAAAATCCGGG
AAATAGTTGAAAGTCAAGAAAAATACCGTAGAAAGGATGT
TAACGCACCCGCGGGCCTTATGTCTCTGCTGTGTTGAAGA
TTTGGGCTTTCTCGCACTCTCTGTGCTGGGACGTATCATT
CGTGTCCACCACATGGCTTGCTATCGCTAAGTTGCCATGG
CAACAGTATCTCCAAAAGACTGCCCCACTGTGGCAGATCA
CTGTCGGGTGAGGAAAAGGAGAGAGGAGGGGAAAGTGAGG
AAGAACTTCTCCTGTCAGTTGTGCGAGAAGGCCTTCAACA
GCTTGGAGAAGTTGAAGGTGCATTCATACTCTCACACAGG
GGAAAGACCGTATCACTGCACACACACTGACTGCACCAAG
GCCTTCGTCTCTAAGTATAAACTCCTACGGCACATGGCCA
CACACTCACCAGAAAAGACACACAAGTGCAGCTACTGCGA
GAAGATGTTCCACCGCAAAGATCACCTAAAGAACCATCTC
CATACACACGACCCCAACAAGGAGGCTTTCAGCTGCACTG
AATGCGACAAGAGTTACAACACGAAACTGGGTTTTCGAAG
ACACCAAGCCCTTCATGCTGCGCAGCGTGGAGACCTCACC
TGCCAAGTGTGCCTGCAGTCATATCCAAGCACTCCCCTGT
TGCTGGAGCACCTACGTGGGCATGCCGGGAAAAGTGCTAC
TGCAACTAAGGAGAAGCGACATCAGTGTGATCAGTGTGAA
AGGCGTTTTTACACCCGTAAGGATGTGCGACGCCACTTAG
TTGTGCATACTGGACGCAAAGACTTCCTTTGCCAGTACTG
CGCCCAACGATTCGGTCGAAAGGATCATCTAACCCGTCAT
GTTAAGAAAAGCCATGCTCACGAGCTGCTGAGGGTCAAGG
CAGAGCCTGTAGATTTGATGGAATCCCAATCCTTGCCAAC
ATCTGGGCCACTCACTCTAAGGTATCCACTCGCTCATGCC
TCCTACTCACCACCGCCACCCTTGAGAGCAGAGCTTGAAA
GTTATCTTCTAGAGCTACAGGCTGAAGATACACCCAAGCT
GAGTTCTTCCACCACGGTGACCGGAGAGACAACATCATCC
CTGGATTTTCTGTCTCCACTGTTTAATTTTCTGCCTTACA
ACCAAGGGGCGGGGTCTAATTTGGGAGTGACTTACAGCCA
GGAGGATGGGATTTTGACCGCTCCCATTCAAGACAGCCCA
GAGCCTCTCAACCTCCTTCACACAATCACACACTCACACT
CGCTGTCACAATCCAACACACTCTCTCCCAGTTATACACA
TTCACCGTCTCTGAATACAACCACCACCCTGCCTCGCTTC
CACCAAGCCTTCCAGTAACCCAAATACATTCACACACTTA
CTTAAGTTTTCTCGCACTTTTTAAAGCACTCTAATGTTTA
TCAACTTAGCCTTTAATACAAAAAGCACAAGTCCCACAAG
GCTTGCCAAGGCAACAATCTGCTCCCTCTTGCAAATACTG
CATTTAAGTCATACTTGAAGAGATGACAAATGCATTTCTA
GTTTTACTTCTTGTCTAGAGGATTTTGAATTACCTCTCCA
TTAAATAGACGTTTAATAGATCAGAGCTCAGATTGCAGTG
AAGTTTTGCTCTTAAAATGCCGACAGAGAAAGCATAGCCT
TTAATGTCCTCTCGTTAACACTTTAAACTTATAGCAAGTT
CCATCAAAACTTAAAGATATTTTTTTTATGTTGTTTCTTT
GTCTGTTGTATGGCTCATGAACTTTTGGGTACTGATATCT
ACCAGCATTTAGTGACCATGTCACATTTACAGCCAAAGGC
AACCAAAACCCTCATAGCTATAGAGAGAAAGGCTCATCTC
GTTATGTTTTTTTTTTTTTAATGGCTGTTTGCCTTCATGC
TGCTGCTCATTGTAAGAGCCTCAAAGGACACCAGCACAGG
AATGCTTCACAGTTCACACCAACAAAGGGAAAGAAGGACG
GAGACTCTCTCTCACACATACACTCATATCCCTTTTCTCT
CTTACTATATTCAACCTCATCCACCAGAATGCTGGCTGTT
GCACTGATCAGAGCTGTCAATCAATGAAAAAAAAACAACA
ACATTCATTTCAGTTTTGCTGTCTCGGTTTAAGCTTATAG
CTTATACTCCAAAAGATGAATGCAATCTGTGACGGACGCT
TTCATTCTATTGACTTTTTAATGTATCTGAATATAAGCTG
AGGGTGTAATTGATTTTGGAATCAAATCTATAGAAGTTTG
TGATCACCATAAAGGTTATTCACACTGACTGTGATTTGCA
AAGCAACCAGTTGCCCCATTTATTTTTACTGAGAGCTGGC
GTTTGAGGTGCCACAAATGACAAAGACCTCAACCCTTATG
CAAATGGCCAGTGACACAATGTGTTGGCTACCAGTGGGAG
TCCGCACACATATAAGATCAGACATATGGTGATCAGCATG
TGGTCAATCTCCAGCGATGTAATCGCTACCATTGTGAACG
TGTCTTCCTCTATAGACATCCTCTAGAGACAGATCTGTGT
GTGTGTGTGCTTGCTTATAGATGATTGACAGATTGTTGGT
TAAATGTGTGTTATGATGGTTTCTGATTTATTTCCTCAGA
AACTGAAGGTTGTTAAAAGCTTAAACATTCAGAATCTCCA
TTTGGGGCATATGT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations