Transcript

msh2-201

ID
ZDB-TSCRIPT-090929-17242
Name
msh2-201
Previous Names
  • msh2-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036796 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036796|OTTDARG00000027380|ZDB-GENE-040426-2932 msh2|OTTDARP00000029502 msh2-001 LG_ BX511072.8 Danio rerio protein_coding KNOWN, 3054 bp
ACCCTCCCGGCGCGCCTGTGCTGTGGCGGGAGATTCCAGC
ATGGCGGTGCAACCTAAACAGAATCTGTCTATGGACAGCG
CGTCTGAACATGGATTCCTCAATTTTTACTTTTCGATGTC
CGACAAACCAGACACCACGGTGCGAGTGTTTGATAGAAAC
GATTACTATACTGTGCACGGGAAAGATGCGATTTTTGCAG
CTAAAGAGGTTTTCAAGACTAATGGAGTCATCAAAAATCT
GGGTTCAGGGAACAGGAGGTTGGAAAGTGTGGTCCTCAGT
AAGATGAACTTTGAGTCATTTGTGAGGGATTTGCTGCTGG
TTAGACAATACCGGGTGGAGGTTTACAAGAACGCCAGTAA
GAGCAGCAAAGAGCATGACTGGCAAATCGCTTTCAAGGCA
TCTCCAGGAAACCTTACTCAGTTTGAGGAGATTCTGTTTG
GCAGTGGCGGAGGGCCTGCTGAGGGTGCTGTCGGTGTGGT
GGGTGTTCGTCTTGGCACTGGCACTGATGGCCAGCGTGTT
GTCGGTGTTGGTTATGTGGACAGTACCCTCAGGAAACTTG
GTGTGTGCGAGTTCCCTGATAACGATCAGTTCTCCAACCT
GGAGGCTCTACTTGTGCAAATCGGCCCCAAAGAGTGTGTG
CTTCCTGCAGGAGATTCAGGAGGAGACCTGGGCAAACTTA
AACAGGTGGTGCAGCGTGGTGGCATTCTCCTCACAGACAG
GAAGAAGTCAGAGTTCACAACTAAAGACATTGTGCAGGAT
CTGAATCGGCTACTGAAGGCCCGTAAAGGAGAGACTGTGT
CCAGCGCTGCCCTGCCTGAGATGGAGAAAAAGATTGCAAT
GTCTTGCTTAGAAGCAGTCATCAAATACCTGGAGCTTCTC
GCAGATGAGGCCAATTTTGGGTCTTTCAAGATGACCACCT
TTGACCTCAACCAGTACATGCGCCTGGATAATGCTGCTGT
ACAGGCTCTCAATCTCTTTCAGGGTTCCTCTGATGATGCT
ACAGGCACTCACTCTCTGGCTGGACTTTTGAACAAATGTC
GGACTCCACAAGGACAGCGACTGGTCAACCAATGGATCAA
ACAGCCTCTCATTGACAAAAACAAGATAGAAGAAAGACTG
GACCTTGTGGAGACATTTGTGGAGGACTCGGAGCTAAGGA
AAAGTTGTCAAGAGGATCTACTTCGTCGCTTTCCTGACTT
AAATCGGATGGCAAAGAAGTTCCAGCGTCAGAGCTCCAAT
TTACAGGACTGTTACCGGGTCTATCAATCTGTGGGGCAAC
TGCCCAATGTGGTGCTGGCACTGGAGAGATACAGTGGAAA
ACATCAGGTCCTCCTGCATGCAGCATTCATCTCTCCACTA
AACGACCTCATCTCAGACTTCTCCAAATTTCAGGAGATGA
TTGAAACCACACTGGACATGAACCAGGTTGAGCATCACGA
GTTTCTGGTGAAACCTTCCTTTGATCCAACTTTGAGTGAT
CTCAGGGAAAACATGGATCGTTTGGAGAAAGCCATGCAGG
CTGCCTTGAGCAGCGCAGCTCGGGAGCTTGGGTTGGAAGC
AGCCAAGACTGTGAAGCTTGAATCCAATGCACAAATTGGT
TATTTTTTCCGAGTTACGTGCAAAGAAGAAAAGAGTCTTC
GCAACAACAAGAAATTCACTACTTTAGACGTTCAGAAGAA
TGGAGTACGGTTCACTAATAGTAAGCTTAGCTCGTTGAAT
GAAGAATACACAAAAAGCAGAGAAGAGTATGAAGAGGCTC
AGAATGCCATCGTCAAGGAAATCATCAGCATTGCTGCAGG
TTATGTGGATCCAGTACAGACTCTGAATGAGGTGATCGCT
CAGCTGGATGCAGTGGTAAGCTTCGCTGTGGTGTCACATG
CTGCCCCAGTGCCTTTCATAAGACCAAAAATACTAGAGAA
GGGTTCAGGCAGACTCGTTCTGAAGGCAGCAAGACATCCC
TGTGTTGAAGCCCAGGATGAAGTGGCTTTCATTCCCAATG
ATGTCACCTTCATAAGAGGAGAGAAGATGTTTCATATCAT
CACAGGTCCAAATATGGGTGGTAAATCTACCTACATCCGT
CAAGTGGGTGTGATTGTGCTGATGGCACAGATAGGCTGTT
TTGTGCCATGTGATGAGGCAGAGCTGAGCGTGGTGGACTG
TGTTCTTGCTCGAGTAGGTGCGGGTGACAGCCAGATTAAA
GGAGTGTCCACTTTTATGGCTGAGATGCTGGAGACAGCAG
CTATTCTTCGGTCAGCCAGTGAGGATTCTCTCATTATTAT
TGATGAATTGGGCAGAGGCACATCCACATATGATGGCTTT
GGTCTGGCCTGGGCGATCTCAGAGTATATCGCCACCCGCC
TCAAGTCCTTCTGCCTGTTCGCAACTCACTTCCATGAGCT
GACGGCGCTGGCACAGCAGGTGCCCACTGTCCGCAACCTC
CATGTCACCGCGCTGACCACAGACAGCACTCTTACCATGC
TCTACAAGGTCAAAAAGGGTGTGTGTGACCAGAGCTTTGG
GATTCATGTGGCGGAGCTTGCTAGCTTCCCCAAACATGTA
ATTGCAAATGCGCGGGAGAAGGCTTTGGAGCTTGAAGAAT
TTCAAGACATCTCCAGTGTTGGGGAGGAAGCAGGACCCAA
AGCCAAGAAACGCTGCATGGAGAAACAGGAGGGAGAGAAG
ATCATTGAGGCTTTTCTGGCTAAGGTTAAATCAATGCCTG
TTGATGGGATGTCTGACAAGGCTGTCAAAGAGGAGCTGCG
CAAACTCAAGGCAGAGGTCATCAGCCAAAACAATAGCTTC
GTCAATGAGATAGTGTCACGCTCTGGCAAGGTCAAACTCA
GTTCAGCCTGAGGGTTAGAAGTTCAACGTTTCTGTAAAAC
TGTTTGTGGCATAATGGAAATGGATACAATCTATAGTAGA
TTAGAAAAAGGTTCCATTTTAATACTGTCTCTTTGGTTTC
AGCTGTTGTTTTTTGGGGGGTTATATTGTAGACCACATTC
TTGTGCGTTTTTCAACATAAATCATCCAACAGACTAAATA
TTTTCTAAATCAGA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations