ZFIN ID: ZDB-TSCRIPT-090929-17162
Transcript Name: htatip2-204
Previous Name: htatip2-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036714 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036714|OTTDARG00000027337|ZDB-GENE-001219-1 htatip2|OTTDARP00000029447 htatip2-003 LG_ CR786573.12 Danio rerio protein_coding KNOWN, 841 bp
GATACATGATGCTTTTCTCAACTGTGAATAATGGATCTGA
ATGCAATGGAAGAGAATTACCGGCAGAAGAACAAAACATG
CTTCATTCTCGGTGGCTCTGGTGAAACTGGAAAAGCTTTG
CTAAAAGAACTAGTGGAGAGAAACATCTTCTCCAGGATCA
CTCTCATTGGACGAAGGCAGTTAACCTTTGAGGACAAAGC
CTATGAAAATCTGGTTCAAAAGGTGGTTGATTTTGAGAAG
CTGGATGAGTATGCAGAGGCGTTTCAGGGCCATGATGTTG
GATACTGCTGCCTAGGAACAACCAGAGCCAAAGCAGGAGC
TGAAGGATTTGTGCGTGTGGATCATGACTACGTACTCAAG
TCTGCAGAGCTTGCCAAAGCAGGAGGTTGCTCACATTTCC
ATCTCGAATCTTCCAAAGGTGCAGATAAAACCAGCAGCTT
TCTCTACCTGAAAACAAAGGGACAGGTTGAAGCAGAAATT
GAAGAGCTTGGGTTTGAGCGGTTATCCGTCTATCGACCTG
CGGTGCTGTTAGTGGACAGACAGGAGAGCCGGCCTTCAGA
GTGGATGGCCAGAAAGTTCTTTGGTGCTTTCTCCACTGTC
TTCCCCACGGCAATGTCTATTCCTATTACATCTGTGGTCA
GAGCAATGGCTGTCAACACACTAAAAGATGGAGAGCAGAA
AGTGGAAATTCTCGAAAACAAAGCCATACACACTCTCGGG
AAAGTTGGAGAAAAGAAATAAGACTTGTGATTGTGGCTTG
TTTAAATATAAGTGCAATTCTAGCATGATGCAGTTTTTTG
TTTTAAGCAAAGCAAGCCAAATGTTGTTTTACTGACATTT
T

htatip2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA htatip2-201 (1)    Ensembl 1214
htatip2-202 (1)    Ensembl 582
htatip2-204 841
ncRNA htatip2-002 (1)    Ensembl 2364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
htatip2-204 Contained in:
[BAC] DKEY-182D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036714 (1),  Ensembl_Trans:ENSDART00000145357 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:CO924177 (1) 876 nt
CITATIONS (2)