ZFIN ID: ZDB-TSCRIPT-090929-17161
Transcript Name: htatip2-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036713 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036713|OTTDARG00000027337|ZDB-GENE-001219-1 htatip2|no_translation htatip2-002 LG_ CR786573.12 Danio rerio protein_coding KNOWN, 2364 bp
GAAGCTGCAGATCAAAAACCAAAGTCCTGTGTTTATCTAG
TTTGGACTGAATGTATTTCAGGGCACCTGTGAAAAAACTC
TAGGCTTCTTCACTGTTTTTGTAGTGGTGCTCGCCGCTGT
TTTCTATTACCTGGAGAATTCAGAGACTTACGAGATACCA
AGAATGGATCTGAATGCAATGGAAGAGAATTACCGGCAGA
AGAACAAAACATGCTTCATTCTCGGTGGCTCTGGTGAAAC
TGGAAAAGCTTTGCTAAAAGAACTAGTGGAGAGAAACATC
TTCTCCAGGATCACTCTCATTGGACGAAGGCAGTTAACCT
TTGAGGACAAAGCCTATGAAAATCTGGTTATGAATCAAGT
TTCAAAATATTATGTCTATGTGATCCAAATAAAAAGAAAA
CCTCCGCAAAAACGTTGCTTATCCCTACAAAAAAATAAAA
ACAAATAAATAAAAATAAAATAATTAACAAATTTGTCAAT
AACAAATGTTAACATTTTAACCCATACCTAATAAATACAG
TAAATCCAGAGGATTGATTGCTAGATAAACATTTTTTTTT
TACGTTTTCAATTTTGGAAACTTTTATTTGTGAGAAAAAT
CTGGGTTATTTCCAGCCTGATCTCATGAGAAAACGTAAAT
ATTTTATGTTTGATAGTTTAGTGGCTAATTAGTACGAATT
CGTGATGAAATGAAATTGTACAATTTTTAAAAGGAGGTGT
GGCACTCAACTCCGCCCCTAAACCCAATCTTCAGTGGGGG
ATGAGCAAATCGTACTAAATTGTATGAATTAGTTTGTGCA
AATTTATTTGAAATAGCCACTAAAAATTACGAATTGCTGT
GAGATTGCCTTGGTTTTTCCACTTAATGTTGATTTCTAAA
CTCTTTTCAAGTGAAAACATTGGTAATGTTTAAATGGGTT
TATAAATTAATTTATAATGCAATCTTTTTTGTAATTTTTA
TTCCAAAAAGTCTATATACAGGGTGTCTGCTGGGTCTTAA
GTCTTAAAATCTCTTAAATTTCCAAAACTACATTCTAGGC
CTTAAAAAGTCTTAGATTCACAGAAATATTGGGCTGTAGG
TCTTAAATAATTTTAAATGGGTCTTAATTTTGCTTTTTCC
AAATAAAGTTACTCAATCGGGCCGACATCCATCCAATTAC
CAACAATGCATCACAATAAAACCTTTTTTGTTTGTTTATA
TAAATGAAAGTTTTTATTATCACAAAGAGATTCACAACAA
CTGTTAGACATCTCTACAGCAAAATCTCCAAACTAAATTC
CCTAATGAGGGAAAGAAAAACTAAAAACAATTACCTGATT
CCTCATAATAATACCAGGCCATTAGAAAAAAATATTTAGT
GTTTAATGCTATAAGTCTAAAATTTCATTCTTAATGATTT
TAAAAGGTCTTAAATTTAAGTTGATGAAACCTGCAGAATA
GTTTATATAAAAACCTGTTTATAAAAAAAACAAGGCAATG
AAATGCTGTATGCACAGTGCAAAATGTTATCAACGATTTA
GTGTTGATTTATCAGTGATTCATCATTTGCCTTTATTGTT
CCCAGGTTCAAAAGGTGGTTGATTTTGAGAAGCTGGATGA
GTATGCAGAGGCGTTTCAGGGCCATGATGTTGGATACTGC
TGCCTAGGAACAACCAGAGCCAAAGCAGGAGCTGAAGGAT
TTGTGCGTGTGGATCATGACTACGTACTCAAGTCTGCAGA
GCTTGCCAAAGCAGGAGGTTGCTCACATTTCCATCTCGAA
TCTTCCAAAGGTGCAGATAAAACCAGCAGCTTTCTCTACC
TGAAAACAAAGGGACAGGTTGAAGCAGAAATTGAAGAGCT
TGGGTTTGAGCGGTTATCCGTCTATCGACCTGCGGTGCTG
TTAGTGGACAGACAGGAGAGCCGGCCTTCAGAGTGGATGG
CCAGAAAGTTCTTTGGTGCTTTCTCCACTGTCTTCCCCAC
GGCAATGTCTATTCCTATTACATCTGTGGTCAGAGCAATG
GCTGTCAACACACTAAAAGATGGAGAGCAGAAAGTGGAAA
TTCTCGAAAACAAAGCCATACACACTCTCGGGAAAGTTGG
AGAAAAGAAATAAGACTTGTGATTGTGGCTTGTTTAAATA
TAAGTGCAATTCTAGCATGATGCAGTTTTTTGTTTTAAGC
AAAGCAAGCCAAATGTTGTTTTACTGACATTTTGAGTTAT
TATCATATAAACTGTTTTTTTAAAAAGCTTTTAAAAATAC
TCATTTGCACTATAAATACGGGTGACGTGTGCTGTGTTTT
AATATAATTCGCTTTGTATTCTTCTGCCTTTTTTGTTATT
TAATTGTAAACTCGTTCATAAAAATAAACAAATCTTAATA
TTGA

htatip2 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA htatip2-201 (1)    Ensembl 1214
htatip2-202 (1)    Ensembl 582
htatip2-204 (1)    Ensembl 841
ncRNA htatip2-002 2364
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
htatip2-002 Contained in:
[BAC] DKEY-182D5 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036713 (1),  Ensembl_Trans:ENSDART00000140367 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:BC081572 (1) 2389 nt
CITATIONS (2)