Transcript

zgc:109982-201

ID
ZDB-TSCRIPT-090929-17148
Name
zgc:109982-201
Previous Names
  • zgc:109982-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036699 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036699|OTTDARG00000027329|ZDB-GENE-050522-139 zgc:109982|OTTDARP00000029438 CH211-252P3.2-001 LG_ BX511118.18 Danio rerio protein_coding KNOWN, 1237 bp
TCTCTTTATCTCCTTCCCGGTACTCATTAGCCTCCGTTTA
CATCTTGTCTGTATCACCATATCGTCAGAGAAAGCAACAT
TTTTTTTTTTTTTATTGCAACTATGAATCAGAAGGTTGTA
CTGATCACCGGTTGTTCCTCTGGTATCGGATTGTCACTTG
CTGTTCGTATTGCCAATGATGAGAAGAAGAGGTTTATGGT
GTATGCCACCATGAGGAACACGGCTAAAGCAGAAGCTTTG
AAGGAAGCAGCGGGTCAAACTTTGGGCCAAACACTGGAGA
TCAAGCAGTTGGATGTCTGTGATGAAAACTCTATCAGAGC
ATGTGTGGACAGTCTGCCCATGGGCAAAATCGACATTCTC
ATTAGTAATGCTGGAGTAGGAATGATCGGCCCTGTTGAGT
GTCAGACCATTGAAGAGATGAAAAGTGTCATGGACACAAA
CTTCTTTGGGCTTGTGCGACTCTTAAAGGTGGTTCTGCCT
GATATGAAGAGGAGAAAAAGTGGCCATATAGTGGTCATCA
GCAGCATCATGGGGATTCAGGGTATTTTGTTTAATGACAT
TTACGCTGCTTCCAAGTTTGCTGTTGAAGGCTTCTGTGAA
AGTCTGGCGGTTCAAGCTATGAGATTCAATCTCAATATCA
GCCTCATTGAACCTGGACCCGTCATCACAGAGTTTGAGCG
TAAGGTGTATGAGGAAGGAATGAAGATAGACCTCTCCAAA
GTTGATAAAGTGACTGCAGATATGTTTACCAACACCTGTT
TGAAGAATTACGACCAAATGTTTAAGAGTTTTGGACAAAC
ACCAGAGGACATTGCAGAGCATGCATTCAAAATGATTACC
ATGGAGAATCCACCATTTCGGCATAAGACGAATGGTTTGT
ACACACCCATGACCACCCTGAAATATGCTGATCCAAACGG
TGACCTTCCCATTGAAAGCTTCTACAAGATGATTTTTCAA
CATGACAAGGTGTTCAAAGCAAGTCTCACTATTCTCAAGC
TCCTGCGCTGGAGAAGCCGTAAGAGCATTACACTGGATAA
AGAAAAGACTGCCTCTTAAGGAATATTCTGCTGGAGCTCT
GGATAGTATTCCAAAAAGCAGGTTAAGCGATTTACCTCTG
TGAGTTTACTCAGAGTAAATGGATAATCTTAAGTTTCGTT
CCAAAAACTAAGGTAACTCTATAAGCAGCTATAAATAGAC
TTACCTTCCACTCTTAATAAAAGTATGAGTACAATCA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations