ZFIN ID: ZDB-TSCRIPT-090929-17089
Transcript Name: zgc:158846-201
Previous Name: zgc:158846-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036626 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036626|OTTDARG00000027289|ZDB-GENE-070209-50 zgc:158846|OTTDARP00000029382 DKEY-195M11.6-001 LG_ CR753817.13 Danio rerio protein_coding KNOWN, 1917 bp
CATATCTTGAAAATTGTTTCTTGACCAATAAGCTGGCCTT
GAGCCACTCCCTGCACTCGATATAAGAGTTTGAAGGAACG
TGTGTCGTCCCACCACTTTTGAGTTTCCATCCCCTCAACT
CCTGGTCCTCTGACAGCTGTTTTGTCCAGAGATGCAGAGC
TCGAAGAAAACTGTTAAGACTTTTAGCAGTCACTCCTCTG
TTGGAGTGAGCAGCAACAGACGGACACCCCTGTCCCGTTC
AGGGATGGTTTCGAGAGAAGGTTGGGGCTCCAGTCCAGTC
CTTTACCCTTCGATTACAGCTGTAAAGGTCAACGAAAGTC
TTCTGGCACCCCTAAACCTGGACATCGACCCGAGCATCCA
GGCCATCAAGACTCAAGAGAAGGAACAGATCAAGACACTT
AACAACCGCTTTGCTTCATTCATTGACAAAGTACGCTATC
TAGAACAACAGAACAAGATGCTGGAAACTAAGTGGAGTGT
CCTGCAGGAACAGACCAGTCGACAGTCCAACATTGATATG
ATGTTTGAGGGCTACATTGCTGGTCTGCGTAGACAGTTGG
ACAGTTTAGGTAATGAGAAGCAGCGCCTGGAGTCTGGCCT
GCGAGACATGAACACACTCGTTGAAGACTTTAAGAGCAAG
TATGAAGATGAAATTAATAAACGAAGCGATTCTGACAACG
AATTTGTGCTTCTTAAAAAGAATGCTGATGATTCATACCT
GAGTAAAGTGGAGCTGGATTGTAAATTGGATGCCCTTTCA
GAGGAGATCAACTTCCTTTGGCAGATTTACGAGGCGGAAC
TCCATGAGCTCCAGACTCAGATCAAGGACACTTCAGTTGT
TGTAGAAATGGACAACAGCAGGAATCTGGACATGGAATCT
ATCGTGGCTGAAGTTCGTGCTCAGTATGAGGAAATCGCCA
GCCGCAGCCGTGCAGAAGCAGAGAGCTGGTACCAACAAAA
GTATGAAGAAATGCAGTTGACCGCAACCAAACATGGAGAT
GACCTGAAAAACTCCAAGGCAGAAATCTCAGAGTACAACC
GAAGAATTGCACGTATTCATTCTGAGATGGAGCTCATTAA
GGGACAGTTCTCAAACCATGAAGCACAGATCAAAGAGGCA
GAAGAACGTGGTGAACTGGCCGTGAAAGATGCCAGGCTGC
GTCTGCAGGAGCTGGAAGCTGCTCTTCTGAGGGCTAAACA
GGACATGGCCCGACAGGTGCGCGAGTACCAGTCACTGATG
AACATCAAACTGGCTCTGGACATTGAGATCGCCACCTATA
GGAAACTCCTGGAAGGGGAAGAAAGCAGACTGTATACATC
ATACCAGACACACTACATCACTAAACCAGGCCCACTCAAC
TACGATCTTGAAAGCAGCTTTGTAGGAGTATCATCCCAAA
ATGCCACAAAGGATATTCATAACACAGGCCTGGTTAAGCA
GGAGGTGGTGGTTAATAAGGGTGGCAGCTCTAGCAGCCTT
ACCACCGTCACCAAAAGCACAAAGACCACTGTCGTCACCA
GTGAGATGGGGAAGACTCTTGTGTCCACAGGGGGAAGTGT
GCAGGTGATGGATAAATCTGCAGTCAAAGAACTGGAGGAT
GTTTTTAACTGATGGGAGGAAAGATTAAAGTGTATTGCAC
AGGATCCAGGATTAGATTTTTTATAGGTTGCCTTTCTCCC
ACTCAACAGTGAGCATGTCCAGTTTGTTGTTAAGGTTTGA
CATATAAAACTGATAACAAGACATACTAAAGATGTAGTAT
ATTTTTAAAGAATATCTGATGTTTGCTTGTTTCCTTTGAT
TAAATGGTTACTAAATATCTGTTAATGAGAACAGTTAAAC
AAAAAGGGGGACACCGTTTGAGCACTTTTCTGACTATTAA
GGACTGTATTCAAATAAAGTGCGTACCACAAATCAAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
zgc:158846-201 Contained in:
OTHER zgc:158846-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036626 (1)
  • Ensembl_Trans:ENSDART00000104074 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC133171 (1) 1966bp
    GenBank:BC154249 (1) 1837bp
    GenBank:DN834344 (1) 764bp
    CITATIONS (2)