ZFIN ID: ZDB-TSCRIPT-090929-17081
Transcript Name: ak4-001
Previous Name: ak3l1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036618 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036618|OTTDARG00000027285|ZDB-GENE-040426-2505 ak4|OTTDARP00000029375 DKEY-202I2.1-001 LG_ CT989254.9 Danio rerio protein_coding KNOWN, 2373 bp
ACTGTACTGATGCGCGCTAACGCCCAACAGCGCGCGCACA
CCCCTCTCGGAGCAAAAACAAACACCACGCACTTCTAAGA
GAGGAGAAGCTCACGTCCTCATAAAAGAGCAGAAGTAGGC
GGCGCGTCAGCGAAGGGCTGCACTGTTTTGATGAACGCTG
ACAACGAGCTGTGTTTTCAACCTGCAAATAACAGTTTCAC
AGTACAGTAGTCTGTTGGGTGGGGCAGTTCAGTGAGAAAA
TGTCCAAGTTATTCCGGGCTGTTATTATGGGTCCACCAGG
TTCGGGGAAGGGGACCATCTCGGAGAGGATCGCGCACAAT
TTCGGCCTTAAACATTTGTCCAGTGGAGATTTTGTTCGAG
AAAACATCTCCTCAAAAACTGATGCCGGTGTTTTAGCCAA
GACGTATATTAATAAAGGACTGCTGGTTCCAGACCATGTG
ATGACACGTCTTTTGTTGCCTCGACTGGAGGAGATGACCA
AATACAGCTGGCTGTTAGATGGTTTTCCTCGGACACTGGC
ACAGGCTGAAGCTCTGAACAGTTCCTGTGACCTGGATGTA
GCCATTAACCTCAACATCCCTCTGGAAACACTGAAAGAAC
GACTGCGACATCGATGGATTCATCCACCCAGTGGGAGAGT
GTACAATATGTGCTTCAATCCTCCGCGCATCCAGGGGCTG
GATGACATCACAGGGGAGGCACTGATTCAGCAGGAGGATG
ACAGACCAGAAGCCCTGGTGGCCAGACTGAGACACTACAA
AGATGTTGCCAAACCTGTCATAGACTTCTATAAGGCTAAA
GGCATCCTGTACACATTCTCGGACACAGAGACAGATCGAA
TCTGGCCCAATATCAACACACTTCTCAGCACAAAGATCCC
AGCCATCCAGTCAGATGCTCGCTGCGCTTCAACCCGCTGA
GGAAATTGTCTGACAATCAATTACATCCAAGAAAACAACA
CAAATTACCAATCGAATACATTGATTTCCAAAGATTCCCT
GCTAGTTATTTTGTGATCACAGCTTGTCTGTTAGTAGTAT
AGTGGTATTTATCAGTGTGCTAACTCTGCTTGTTTCAATT
CCTGTAAAGATTTCATACATTTCAGGGACCAGTTCTGCCA
TTTCAGCATTTGCTGGAATCATGGGTGTCAGTCTGGGTAA
AATCCAGCTTAAATTCAATAAAGATGTCGGTTCCTCTATT
TAAAATGCACAAAATTCCATGTGCACGTGACTGAATCATG
AATAATAAGTGAAGGGTAGATTCTTATGACTTTGTGTGTG
TAATTCTAGCTGGAAGGCTTTATAAGATCTTTGTGGTGTT
TGCCTTTCTCTGTTTCTGATTTGTTGAGGTGATATGTTAC
TACACACCCAAAAGAATGGTGTAATTATTTTTAAGCATTT
TACACCCTCAGAAATAAAAATACACGAGCTGTTACTGGAG
TGGTACCTTTTCAAAAGGTACACATTTGTACTTGAATGGT
CCATATTGGTATCTACAAATATATCTACAAATTTTTGGAG
GAACACTTTTGTACTTTTGGGGACTAATAAGTACTCTTGA
TTTATTAAAATGGACCTATTAGGTACTGTGATAGTACCTT
TCGAAAAGGTACCACCCCTGTGATAGCTCGTCTGCCTTTA
TTTCTGAGAGTGTACATGCTCTAGAATCCAAATATGCCAC
ATTTGCCTTGAAAGTACAATTTCTTTTATTTTGATGTGCT
GAAGTTGCTTTTGTGGTCGCCAGGTCTTATATGTTGAATT
CTGTCAACGGAATGTGTTGAAAATGAAACTGAATTTTTAC
GTAACTATAGAAAATGGCTATATGTTAGTGTATTGAGATA
AAATATATCAGATGTTCTTTAAACACTGCCTCCTTTTTAG
TAAATACTGTTCAGTGTTGTGTTTCTAACAGACAAGTCAG
TGAGATCCTGTTTTATATATTACGTGATTATATCTTTAAA
CCATTTGTGATTTAATAACTGTTGAGTGTGTTCAGATAAA
ATAATAGTGACATCTCTTTTATCCAGAAGATTAAAGTACA
AATTTGCTAGAAACCACAGATTAAGTTACAATTCGATTAT
AATTTGTCCCTAAAACAAAGATAAGCTGCATGACCTACTG
TAGGTGTTGTAAACATGACTTCATGCTTATCAACTGTGAT
ATTTTTGTTCAGTTTTTTATTTTATTTTTTAGATATACAT
AGATATGCTTTCTTGCTTCACTCTCTCTCTCTCATTTTCC
AGTTCTATATACCAGCCAAAAAGGGTTGGAGAAAACTCTC
AAAAGCCTATTGTTGTGCAATACCATATACAAGAAATGAC
ATGACTGAGCTTTCCCTGTCCCCGTTAAGAAAATAAACTT
ATTTTCTCAAAAA

ak4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ak4-001 2373
ak4-002 (1) 1015
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ak4-001 Contained in:
OTHER ak4-001 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036618 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC068387 (1) 2228bp
    GenBank:EH486055 (1) 986bp
    GenBank:EH539841 (1) 914bp
    CITATIONS (1)