header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-17082
Transcript Name: ak4-202
Previous Names: ak3l1-002, ak4-002

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036619 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036619|OTTDARG00000027285|ZDB-GENE-040426-2505 ak4|OTTDARP00000029376 DKEY-202I2.1-002 LG_ CT989254.9 Danio rerio protein_coding KNOWN, 1015 bp
CGCGTGTAAAGAAGCTGTTGTAGCACATAAGTCCATTGGT
TCTTATAGTCTTATATGTTGCGAGTCGTCTTATTGCACTG
TACTGATGCGCGCTAACGCCCAACAGCGCGCGCACACCCC
TCTCGGAGCAAAAACAAACACCACGCACTTCTAAGAGAGG
AGAAGCTCACGTCCTCATAAAAGAGCAGAAGTAGGCGGCG
CGTCAGCGAAGGGCTGCACTGTTTTGATGAACGCTGACAA
CGAGCTGTGTTTTCAACCTGCAAATAACAGTTTCACAGTA
CAGTAGTCTGTTGGGGCAGTTCAGTGAGAAAATGTCCAAG
TTATTCCGGGCTGTTATTATGGGTCCACCAGGTTCGGGGA
AGGGGACCATCTCGGAGAGGATCGCGCACAATTTCGGCCT
TAAACATTTGTCCAGTGGAGATTTTGTTCGAGAAAACATC
TCCTCAAAAACTGATGCCGGTGTTTTAGCCAAGACGTATA
TTAATAAAGGACTGCTGGTTCCAGACCATGTGATGACACG
TCTTTTGTTGCCTCGACTGGAGGAGATGACCAAATACAGC
TGGCTGTTAGATGGTTTTCCTCGGACACTGGCACAGGCTG
AAGCTCTGAACAGTTCCTGTGACCTGGATGTAGCCATTAA
CCTCAACATCCCTCTGGAAACACTGAAAGAACGACTGCGA
CATCGATGGATTCATCCACCCAGTGGGAGAGTGTACAATA
TGTGCTTCAATCCTCCGCGCATCCAGGGGCTGGATGACAT
CACAGGGGAGGCACTGATTCAGCAGGAGGATGACAGACCA
GAAGCCCTGGTGGCCAGACTGAGACACTACAAAGATGTTG
CCAAACCTGTCATAGACTTCTATAAGGCTAAAGGCATCCT
GTACACATTCTCGGACACAGAGACAGATCGAATCTGGCCC
AATATCAACACACTTCTCAGCACAAAGATCCCAGCCATCC
AGTCAGATGCTCGCTGCGCTTCAACCCGCTGAGGAAATTG
TCTGACAATCAATTA

ak4 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ak4-202 1015
ak4-203 (1) 2373
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ak4-202 Contained in:

OTHER ak4-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036619 (1)
  • Ensembl_Trans:ENSDART00000134370 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CN319187 (1) 772bp
    GenBank:DY559245 (1) 696bp
    GenBank:EB912728 (1) 502bp
    GenBank:EB909395 (1) 238bp
    CITATIONS (2)