Transcript

fhl2b-002

ID
ZDB-TSCRIPT-090929-17073
Name
fhl2b-002
Previous Names
  • zgc:103466-002
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036610 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036610|OTTDARG00000027279|ZDB-GENE-041010-121 fhl2b|no_translation CH211-147G19.1-002 LG_ CR936426.12 Danio rerio protein_coding KNOWN, 518 bp
GAACCCTTTACCCTCTCGCTTTCCCTAATTAGATGTTCAA
AAGCTGAAAAAGGCCACTGAGGCAAAGCACATTCGGTTTA
ATGCAGGTGTGACAGAATGTAGGTTCAAAGTCTTTACCTT
TATGCGTTTCTCTACTCAGGATCTGTCTTATAAAGACCGG
CACTGGCACGACGACTGCTTCCACTGCTTCAAATGTCACC
GTTCTCTTGTGGACAAGCCATTTTCTACCAAGGACGAGCA
GCTACTGTGTACCGAGTGCTACTCCAATGAGTATTCCTCT
AAATGTTTCGAATGCAAGAAGACAATCATGCCAGGCTCCA
GGAAGATGGAGCATAAGGGGAACAGCTGGCATGAGACCTG
CTTTACCTGCCAGCGCTGTCAGCAGCCCATTGGAACCAAG
AGCTTCATTCCTAAGGACAACAGTAACTACTGTGTGCCGT
GCTACGAGAAGCAGTTTGCTCTGCAGTGTGTGCAATGCAA
GAAGCCAATCACCACCGGGGGCGTGACCTATCACGACC

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations