Transcript

fhl2b-201

ID
ZDB-TSCRIPT-090929-17072
Name
fhl2b-201
Previous Names
  • fhl2b-001
  • zgc:103466-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036609 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036609|OTTDARG00000027279|ZDB-GENE-041010-121 fhl2b|OTTDARP00000029369 CH211-147G19.1-001 LG_ CR936426.12 Danio rerio protein_coding KNOWN, 1785 bp
ATCTCTCAAGAACTAAAGACGCATAGCACATCACATCACA
CCACTCCTCTCCTCTCCACGGGACAGGGATTGTTTAAAAC
CGGAGATGGCGGAGCGCTATGACTGCCACTACTGCAAGGA
GTCTCTGTTCGGGAAGAAGTACGTCCTGCGGGATGAAAAT
CCATACTGCGTGAAGTGCTATGAAAGCCTCTACTCCAATA
CCTGCGAGGAGTGCAAAAAGCCCATTGGCTGCAACAGCAG
AGATCTGTCTTATAAAGACCGGCACTGGCACGACGACTGC
TTCCACTGCTTCAAATGTCACCGTTCTCTTGTGGACAAGC
CATTTTCTACCAAGGACGAGCAGCTACTGTGTACCGAGTG
CTACTCCAATGAGTATTCCTCTAAATGTTTCGAATGCAAG
AAGACAATCATGCCAGGCTCCAGGAAGATGGAGCATAAGG
GGAACAGCTGGCATGAGACCTGCTTTACCTGCCAGCGCTG
TCAGCAGCCCATTGGAACCAAGAGCTTCATTCCTAAGGAC
AACAGTAACTACTGTGTGCCGTGCTACGAGAAGCAGTTTG
CTCTGCAGTGTGTGCAATGCAAGAAGCCAATCACCACCGG
GGGCGTGACCTATCACGACCAGCCCTGGCATAAAGACTGC
TTCCTGTGTACTGGCTGTAAGCAGCAGCTGTCTGGCCAGC
GCTTCACCTCTCGTGATGACTTTCCCTATTGCCTCAACTG
CTTCTGCAATCTGTATGCCAAGAAGTGTGCTGCCTGCACC
ACCCCGATCAGCGGTCTGGGAGGAAGCAAATACATCTCTT
TTGAAGAGAGGCAGTGGCACAACGACTGCTTCAACTGCAA
GAAGTGCTCAGTGTCTCTGGTGGGCCGTGGATTCCTGACA
GAGAGAGATGATATTCTGTGTCCCGAATGTGGAAAAGACA
TCTGAGCAGACAGCGCGGCACTGCAATTCCTAACATTTTA
TTTTTTAACAAAGTTACAAATTCTATCAAAGCTGATGTAT
TAGTCTAACAAAAGTCCCATTTAGATAAGTCACTTTAAAG
GGGCCTGTGCATGCCAAGGCCTCGTATTAAAATCGTGTCT
TGTTTAAAATCGTCAACTAAAAGAAACATGCATTTTCTGA
AGACATAAAGCATATTTACTGTTTTATTTGGAAGTGTTAT
TGCCTATTTACTAGTTGCTTGTGCCCAGTGTTGGGTGTAA
TTAGTTACAAAGTAATAGTTACTGTATTTATATGAGTTTT
CCAAAAGTAAAGTAAGGAATTACTTTTAATTTTTAGGTAA
TCTAGCTACATTTACTCATGAACTAGCCTTAAATATTCAG
ATTAATTGTATTATTTTTTTTGTTATACATATATATTTTG
CTGAATAATTATATTTTTCGACTAAAGTTGGTTACATTTA
TCTAGTTGATGAATGGGCTATATGCTAGGCATGGGATGAT
AAATGTTTTCAAGGAATATCGCGGTTTGTAAAAGTCAAGG
TTCTGTAGCCAAAGTTTTCTGCTATACTGTTCCTACCGTA
TATGTAAGATTTAATTTTTTTTTATGTTTTGTTTGAAGTT
TTAAAGGACAACAGTATCTCCAGCAGAAAAGATATCCAAA
GATGCCGTCTTAAATTGTTATGAAATCTGTTTTTGAAACT
ACTGTAAAGAAGACAGCAGAAATCAAAGATTCATTAAGCC
TGACATGTTTACTATCCCAAAATATCTTAAAAGTTTCTTA
AGATAAAATACATTGTGTTTAAAGCAAAAAATTTTTTTTA
GCTTTTTTACCCAGACATTTAAAAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations