ZFIN ID: ZDB-TSCRIPT-090929-16987
Transcript Name: atf1-201
Previous Name: atf1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036510 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036510|OTTDARG00000027223|ZDB-GENE-030131-4334 atf1|OTTDARP00000029290 atf1-001 LG_ CR388364.11 Danio rerio protein_coding KNOWN, 2140 bp
ATCTTGCGTTTCACTGCTATTGGCCAATCACAAAGCGTAA
TACAGCTTTACGTAACACGTACATCTAGGGGGCGGCGCTT
ATCGCGGCCTTTAGAAAAAAAACCCTGAAGCCATCTAGAA
TTTTTCAATGGAAACCGCCCAGCTTTATTCAATGCATTAT
TAAATCAATTACTTTTCCGCTTATCCCTCTAATACTGGCA
TCTACGTAGACGGCGTCGTCGTTTCCAGGAGCGCTTCAAA
CGGATAAGAGTGGCAATGGAGGAGGTCCAGCACAATAATG
GCTCTGAGTCTCAACCTGTTTCCGTCGCCACAACTATAAC
TGCCTCTCACCTATCACAGATTGCCCAGATGTCTCTGGGT
GGTAATCCAGTGGCTGTGGTTCAGCTGCCCAGCGGTCAGT
TTCAAGTTCAAGGCGTGATTCAGTCAGCACAGTCATCAGT
TATCCAGTCTCCACCAGTACAATCACAGGGCCAAGGGTCT
GACAGTGACGATTCTCAGGAATCAAGCGACAGCGGAGCAT
CAAATCAGAAGTCAAGAGAGATCTTAGCTCGGCGCCCATC
TTACAGGAAGATCCTAAATGATCTGTCAGCGGAGGAGCTG
GCAACTCAGAATGAGGGAGAAGAGGAAAGTTCCACCTCCT
CTGCCATAACAAGCGTCTCACTCCCGACCCCAATCTACCA
GACAAGCACTGGCCAATATATTGCGATTTCATCCAATGGC
TCTCTTCAGCTGGCCAGTGCTGGTTCAGAGGGTGTACAAG
GCCTACAGACTCTCACCATGTCCAACTCCAACCCAAGCCA
GCCAACTATACTGCAATATGCTCAGACTGCCGACGGACAA
CAGATTCTGCTGCCTAGCAACCAGGTGGTTCTCCAAGGTG
CAGGAGGAGAAATGCAAGCTTATCAGATCCGCTCCTCTTC
CTCCTCGCTGCCTCAGACTGTTGTCATGACTTCACCTGTT
ATCAACTCTCAGGGCAAGAGCGACGACCCACAAATGAAGA
GAGAGATACGGCTGGCCAAGAACAGGGAGGCAGCCAGAGA
GTGTCGCCGAAAGAAAAAGGAGTATGTGAAGTGTTTGGAG
AACCGCGTGGCTGTGCTGGAGAATCAGAACAAGACTCTTA
TCGAGGAGCTCAAGACATTAAAGGACCTGTACTGTGTTAA
AACTGGCTAGTGGGAGATCCCTCCAATCACGCTAATGGGA
CTTTGCTGGCAGACCTGTGTGTCTGCTTATGTGCTTACAC
AAACACAGACAGGGACTTTTTTCTGGCAAGAGGAATACAT
TTATTCCTCCTGTCGAATGCTTGTTTTTATACAGCTCATT
TTTAACTAATAGCCTAAGAACGATTGACCAGAAACAACAG
CAACAATTACGCTTTTAAAAATAGATGGAAAGAGGGATTC
GTTTTTTTCCATTAACATATTTTTATTTGCCGTCGACAGA
TGTTTATATTTGTGTATGTATCTTGTGCAAGCGTTGGCAC
GTCTACACTGGGAGATCTTGCTTTATTCTTGACCCATTTG
GTTTTTCCAGGGAAGTTTTGAATGTTAATTTTATTGAAGC
GCTAGCTGAGCGCATTAGCTGTCTGTTGAGGTGACAGACT
GGTATTTTTACACCTTATCTCAAATGCGCTTGTATGTATG
AAAATTGTGACGCAATTGTGTTTTTTTTTTTCAAGTCATG
CAGCTGTGTTCTTTGCATTTATTTTGTGCTATTTACCCCT
TTATAGGAAGCTCTGGCATTCCTATCCCCATTCCGTATTT
TGTTTTACGTTTAGTGAGACATTTTCTACAGAGACTGAGC
AGATTTTAAGGTGAGGACTTTCAGCTTTACTATTATTGGT
AACATTCAAGTCATTAAGTCATTTTAAGCCTTATTGTGGA
CTGATAGACTAATCATGTAGAATTGAAACCTTTTTAGTCC
AAGCCTTGGTAATATGTCTAACTGGTCTTTAAGCCATTCA
CACACTTGGGTTGGGACCGTGTTGGCTTTTAGCTGATTAA
TAGACCCGAGGCTTACCACTGTTTATAAGCCAAGCTGTTA
CACGACAATCGAATCAGGGAGCATACGATGAAAAACAAAA
CATACAATGTCACTTGTTTTAGGTAAAGTGAATCTAAATA
AATATTTTTCCAGCCTTTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
atf1-201 Contained in:
OTHER atf1-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036510 (1)
  • Ensembl_Trans:ENSDART00000065038 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC053252 (1) 2077bp
    GenBank:CK710167 (1) 721bp
    CITATIONS (2)