Transcript

atf1-201

ID
ZDB-TSCRIPT-090929-16987
Name
atf1-201
Previous Names
  • atf1-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036510 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036510|OTTDARG00000027223|ZDB-GENE-030131-4334 atf1|OTTDARP00000029290 atf1-001 LG_ CR388364.11 Danio rerio protein_coding KNOWN, 2140 bp
ATCTTGCGTTTCACTGCTATTGGCCAATCACAAAGCGTAA
TACAGCTTTACGTAACACGTACATCTAGGGGGCGGCGCTT
ATCGCGGCCTTTAGAAAAAAAACCCTGAAGCCATCTAGAA
TTTTTCAATGGAAACCGCCCAGCTTTATTCAATGCATTAT
TAAATCAATTACTTTTCCGCTTATCCCTCTAATACTGGCA
TCTACGTAGACGGCGTCGTCGTTTCCAGGAGCGCTTCAAA
CGGATAAGAGTGGCAATGGAGGAGGTCCAGCACAATAATG
GCTCTGAGTCTCAACCTGTTTCCGTCGCCACAACTATAAC
TGCCTCTCACCTATCACAGATTGCCCAGATGTCTCTGGGT
GGTAATCCAGTGGCTGTGGTTCAGCTGCCCAGCGGTCAGT
TTCAAGTTCAAGGCGTGATTCAGTCAGCACAGTCATCAGT
TATCCAGTCTCCACCAGTACAATCACAGGGCCAAGGGTCT
GACAGTGACGATTCTCAGGAATCAAGCGACAGCGGAGCAT
CAAATCAGAAGTCAAGAGAGATCTTAGCTCGGCGCCCATC
TTACAGGAAGATCCTAAATGATCTGTCAGCGGAGGAGCTG
GCAACTCAGAATGAGGGAGAAGAGGAAAGTTCCACCTCCT
CTGCCATAACAAGCGTCTCACTCCCGACCCCAATCTACCA
GACAAGCACTGGCCAATATATTGCGATTTCATCCAATGGC
TCTCTTCAGCTGGCCAGTGCTGGTTCAGAGGGTGTACAAG
GCCTACAGACTCTCACCATGTCCAACTCCAACCCAAGCCA
GCCAACTATACTGCAATATGCTCAGACTGCCGACGGACAA
CAGATTCTGCTGCCTAGCAACCAGGTGGTTCTCCAAGGTG
CAGGAGGAGAAATGCAAGCTTATCAGATCCGCTCCTCTTC
CTCCTCGCTGCCTCAGACTGTTGTCATGACTTCACCTGTT
ATCAACTCTCAGGGCAAGAGCGACGACCCACAAATGAAGA
GAGAGATACGGCTGGCCAAGAACAGGGAGGCAGCCAGAGA
GTGTCGCCGAAAGAAAAAGGAGTATGTGAAGTGTTTGGAG
AACCGCGTGGCTGTGCTGGAGAATCAGAACAAGACTCTTA
TCGAGGAGCTCAAGACATTAAAGGACCTGTACTGTGTTAA
AACTGGCTAGTGGGAGATCCCTCCAATCACGCTAATGGGA
CTTTGCTGGCAGACCTGTGTGTCTGCTTATGTGCTTACAC
AAACACAGACAGGGACTTTTTTCTGGCAAGAGGAATACAT
TTATTCCTCCTGTCGAATGCTTGTTTTTATACAGCTCATT
TTTAACTAATAGCCTAAGAACGATTGACCAGAAACAACAG
CAACAATTACGCTTTTAAAAATAGATGGAAAGAGGGATTC
GTTTTTTTCCATTAACATATTTTTATTTGCCGTCGACAGA
TGTTTATATTTGTGTATGTATCTTGTGCAAGCGTTGGCAC
GTCTACACTGGGAGATCTTGCTTTATTCTTGACCCATTTG
GTTTTTCCAGGGAAGTTTTGAATGTTAATTTTATTGAAGC
GCTAGCTGAGCGCATTAGCTGTCTGTTGAGGTGACAGACT
GGTATTTTTACACCTTATCTCAAATGCGCTTGTATGTATG
AAAATTGTGACGCAATTGTGTTTTTTTTTTTCAAGTCATG
CAGCTGTGTTCTTTGCATTTATTTTGTGCTATTTACCCCT
TTATAGGAAGCTCTGGCATTCCTATCCCCATTCCGTATTT
TGTTTTACGTTTAGTGAGACATTTTCTACAGAGACTGAGC
AGATTTTAAGGTGAGGACTTTCAGCTTTACTATTATTGGT
AACATTCAAGTCATTAAGTCATTTTAAGCCTTATTGTGGA
CTGATAGACTAATCATGTAGAATTGAAACCTTTTTAGTCC
AAGCCTTGGTAATATGTCTAACTGGTCTTTAAGCCATTCA
CACACTTGGGTTGGGACCGTGTTGGCTTTTAGCTGATTAA
TAGACCCGAGGCTTACCACTGTTTATAAGCCAAGCTGTTA
CACGACAATCGAATCAGGGAGCATACGATGAAAAACAAAA
CATACAATGTCACTTGTTTTAGGTAAAGTGAATCTAAATA
AATATTTTTCCAGCCTTTAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations