ZFIN ID: ZDB-TSCRIPT-090929-16938
Transcript Name: nfil3-5-201
Previous Names: nfil3-5-001, si:dkey-52h23.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036454 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036454|OTTDARG00000027193|ZDB-GENE-030131-7677 nfil3-5|OTTDARP00000029253 DKEY-52H23.1-001 LG_none BX601645.15,CR627490.6 Danio rerio protein_coding KNOWN, 4331 bp
ATAACATAAGGACGAAGAGGGAGGGAGAGGTAGACGGCGA
ATAGCAGCACATTCAGGGAGTCACATTAATCGACACAAAG
CCGGTGAGTGGATCACGACCCACGCGGGACATTTTCATCC
CAGACTGAAGTTGTAAAAGGACGAAAGAACACAATCGGGA
CGATTAACTGCATATAGAGACACGGAGGAACGATCTATTG
AAGAATAAAGAGGATTCCTGTGTTTAACGAAAGGAATGCG
CTATTTGACTCAGATCTGTTCAACAGAGACTGAGATAAAA
CACTGAGCTGAGACTGATCTGACGAATGATCCAACATTTT
TCTGAGGGTGCTTAAAAAAAGTTTATTCTCTAACAGCAAT
CCCAGCCTGAAGGCCACCATAAAGAACAAAGAACAAAACA
AGGAAAAGAGGTGACATAACGAACAAGGGAACAATAAGGA
GTTTGTCTGAAAACTGAAAGCGATTAAAAACAAAAAAACA
AAAAGACTATCCCATTTCTGGGAGAAGAAAACTTGGAACA
CACCTGCCCAATGACGGTTGTTTTTGTAGAGTTCCATCTT
TTTCTTATCTTTTTGACTAGTCTGGACACTTGAAAATATA
GTAAACTGTTTAGAGTGGAAGGAAAAGGCCATCAGTCAGA
AAAAGCTACAGTTCCTCTTTGGAGGCGTAAACAGAACCTC
GTGCATCAGCATACATACAATCGTGTGCGTTTTTCAAGTT
TCGATCAGAAACAAATACTCTTCAGTAAAAAAACATTACT
TTTCAATGTCCACTGAGAGCCAGTCATACAAACTGGCCTC
AATAGGACAACAATGGAAAGCATAAATCTTCCAACCCAAA
ACAGCGGTTCCAGCTTGGAAACACTAGAAACATTCTCAAA
CTACAATGAGAGTTTACCATCTCCTCAAATGAGCAGCCCT
CCTCGTCAAGGGCGTCTAATAAAACCAAAGCCCAATTCAT
CTTGTCGACGGAAACGGGAGTTCATCTCCGATGAGAAGAA
AGATGCATCCTACTGGGAAAAACGACGCAAGAATAACGAG
GCTGCCAAGAGGTCAAGGGAGAAGCGGCGGCTCAATGATA
TGGTTCTGGAGAACAGGGTAATAGCACTGAACGATGAGAA
TGTCCGGCTGAAGACAGAACTCCTGCAACTGAAATTAAGA
TTTGGACTCATAAGCTCTGCTTCTTACATGGAAAAGACCC
AACAGATAAGCAATGGTGCTGAGGCAGCAGCTAATGGAGC
TAATGGTTCCGGAGCGACCTCTGGGAATCCGTACTTCTCA
AGCAGTGGATACTCCAGTGCTTCTCAGGTCATGATGAATT
CTGATTCCTCAGAGGCTGAGCAGTCAACCAGGACTGAACG
GCACACAATGTTACCCAAGTACTCCCCCCGTGGATCACTG
TCTGACATGTCTGATGGATCTTCAAGGGACAGTCCTGAGC
CTATAAACTTTGACATCAAACACGAGAGCTCCGGAATGGA
CATTAACAGGCTTGAGGCAAGTGTTCTTAATGGCATGTTT
AATGGCCATCAAAGTCTTGGACGACTGGAGTCCAACCAAC
CACAAGAAATGGAGCAGCAAGAAAGTGTCAGCAATCCAGC
CCCTCCATCCGCCACACCCCAAAGAAGTGTCATTCTCTTT
CGTTCTGGAAGCAGCTCCTACCCTGTTGAGAGTCAGAGGG
TTGAGGATGTAGATCAGCAGGAGGCATCCCAAACACAACA
AAATGGGCAAATCACTCATTTTAACCAAACAGGGTGCAAT
CTCCCGCTAAGACATGACGGTTTAGAGACTCTTTCAGAGG
TGGCACAGCAGTTGGCCAGGAGGTCTTTGGATTCACCAAG
CTATGAATTCACTAACGGAAAGGCAGATGCTGGGGAAAAC
AGGCGGTTTGTCATACAGCAGCAAGACCTGACCGTTCAAG
GACAATGCAGAAGTCAGGTTCAAGACAGCACCCCTAATTC
TTTTGCCCCAGATTTGCTCAATGAGGCTGGAAAAGCCCTT
GTATACCAGCGGACAAATCCCTACCTCGGCACTCTGAACG
AGGAGCCACCAGTGCTGACTTATGAAGGTTGCACAAGAGC
AGATGGCTTTTACCAAGAGCACTCTTCCTCGGGGAAGGAC
AGTTCCTCTAGTGATGGAGACCCACGCAGCTCAGATAAGG
AAGCTTCCACTGACGATGAATCTCCCTCATCCTCTTCCTC
TGATATTGGTGGATATCACGCCACCCATCAGTCAGCCTCC
TCGCCCACTATGGTCACCAGTGATGCTTACCAGTATGGTG
ACAACCAAGGTGAAATGAAAGGCACTGCTCTGCCTCACAA
GCTAAGGCTCAAGTATAGAGCGCTGTCCAACGGTGGCTCG
CAAGATGTCCAAGCCACCACAGCAGCTATGTCCCCCGAAT
CTGCACTGCCACAGCACCCATACCTGGCGTTAGCACAGGT
TAACCAGCAGCAAGGCAGCAGCTTTGGAAACAAGGAGGGC
GAAAGCGAGACGGCAGATGAACTTTGCACGCAACGGTCTC
CTTCAAGAGACAAGGACATGGGATGGAAGGAAAGTGGGAA
GAGGAGCTCAGGAGGACGAGGTAACAGAAACAAGAAACGT
GACTGAAACTGGCACATTACAACGCTTAAGACAGGACTTG
ATAAATGTCATCTCTACCATCCAATGGAAAGTCAAAAGAA
ATGGTACCAGTTACTTGCATGGAAGTCTATTGCTTATTCG
TAACAAGAAAGTAACTCATGTTCTTGGTTTGTTTTCTTAT
CAAGAGCAATTCTGTGACCTTTTAATGCAGCTCTGTTCTC
TCACTCTCTTTCATAAGCACTTAACTGTAACTCAAAGTTA
CAAAGGGGAAACTGAGTTCTTTAAAACGATCTTTTTCCTC
TGTCAAAACAAACCGACAAAACTCTGTACAGCAAACCTCG
ACTCCACCTTTGAATATTTACATATCTCTGCCGTGTTTAG
TAGCTTAGCTATAGAAATGGGTATTTACTGACCCTTACAA
TTTCCGCCACAAGTTCAAGGAGTTAAAGTTCTTTCTCAAT
TCTGATTTCAGAAGTAAAAAAACCTCAACAGTTTATGCCT
CTCCTCTGCCTTCGGACTTTAACATTATTGAAGCACTTGG
ATTATAATACTGTGACATGACTAAACATATCATATTTCAA
TATATTTTATGAAAAAATGACAATGTCAATCTTTTAAGAG
TAGAAAAGTGGGCAAAAGACAACAAACACTGTCTACTTCT
TACTGTTTGAATTCCTGTATAGTCCTTTCTTAATGTCTGA
TGCTTCCACTATATTTTTTAAGTCGTCATCGCTATGTCAC
TGTATTACACCAATTGACAGACACCAGAATGCTCTCTTCA
TAGTGTTTGGTCATTCATAGGTCAAGGTTATCCAGTGAAA
AATCATCTCTCGTCCACCGCATTACGTTGTATCACTGTAA
AGGAGCCTGATGGATCGATCCTCTCCAAAGGTCACTGTGA
CCAACCCTTTTTTAAAAACAAAAGAAAAGTTGCAATCTGC
CTGACATTTAGCCAAATTAGAGTAAAAGCCCTTTCAGAAA
TGTCAAGGTGGTCTCTTCCAAGGCCTGAGTTAATATGCGG
ACTGTACAAAGTGTAAGATATATCATTGCCATCTCAAGAT
GGTTTTGTCCTCTGTGGTCAGGCTTCAGAGATGCCTCACA
TGCTACCTCATGAGAAGAAATGGTTGAGGTTACGCAGAAC
TGAAGTGTTTCTCCTTTGGTGTGTGTAGCCCATTGCATCA
TCGTACCCATTAACTGTTGCGTATAAAAGTTAACACACAA
GAAAAATGCTGCAACACACAACTAAGTGTTACCGACACAC
AGTTTAGTCCCACTAGTCGTCTTTGTAGAATCTACCACAG
CTGAAAGCTGCTTCTGCACTGAATTTTTTTCATCAGATTT
TATACAAATCTGTGTTTATTGTTCCCAAACAGGTGCCTGG
CACTGGCCATTATGTAAAAAGTGTACATACAAATTCTCTT
TTTGAGTATTTTAAGTTTGTATCAAGTTTATTTTGGCATT
CTATAATAATTATTATTATTAATATTGTATTTTATTTTAT
ATTCCAATGCTTTCCTTCTCTTTGGGTTCATATTTCTTGT
GTCTGATCACCTCAATGTGATGCAGTATGTATTTCCATGT
CCTGTGCATCTATTTCACCTCTGTACCCTGGTGTATTGTG
TGGTATTTACTGAAGTTTTAAGTAAAAAAAAAAAATGTTT
GTTAAAAAGAGGTTGGTGTACCTGTCAAGGTGCTCAGAAT
GACACTAAATGAGTGGAAAGAAAAATAAATCATGTTGTAC
GTTGAATTTAA

SEGMENT (CLONE AND PROBE) RELATIONSHIPS
nfil3-5-201 Contained in:
OTHER nfil3-5-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036454 (1)
  • Ensembl_Trans:ENSDART00000146106 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC060943 (1) 3468bp
    GenBank:CT606756 (1) 587bp
    GenBank:EH437687 (1) 484bp
    GenBank:EB775347 (1) 479bp
    CITATIONS (2)