ZFIN ID: ZDB-TSCRIPT-090929-16927
Transcript Name: cdkn2a/b-201
Previous Names: cdkn2a/b-001, cdkn2b-001, si:dkey-123o10.1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036443 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036443|OTTDARG00000027187|ZDB-GENE-081104-306 cdkn2a/b|OTTDARP00000029243 DKEY-123O10.1-001 LG_ BX323448.7 Danio rerio protein_coding NOVEL, 378 bp
ATGATGAACGTCGAGGATGAACTGACCACAGCAGCAGCCA
CCGGAAACATTTCCCATGTTCAGTTTTTACTTTCTAACGG
AGTGAATGCCAATGTGGTTAACAAATTTAGAAGAACGCCT
ATACAGGTGATGATGATGGGTAACGCACCTTTGGCTCTTG
TGCTGCTGGAACAGGGAGCGGACCCTAATGTGCCTGACCC
CGACACAGGGAGCACACCTCTGCACGACGCTGCCAGAACC
GGATTCATTGACACCGTGCGGCTTTTAATCCGCTTCGGCG
CCGACCCCAATACAAAAGATCACTGCGATTTACGACCAGT
GGATGTGGCACAACAGACTGGCAACGTAGACGTGGTTGAA
TTACTCAATCGTGTTTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
cdkn2a/b-201 Contained in:
OTHER cdkn2a/b-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036443 (1)
  • Ensembl_Trans:ENSDART00000054209 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCESNo data available
    CITATIONS (2)