header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16911
Transcript Name: ccdc43-202
Previous Name: ccdc43-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: aberrant processed transcript
Annotation Status: nonsense mediated decay
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036427 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036427|OTTDARG00000027179|ZDB-GENE-040426-1587 ccdc43|OTTDARP00000029231 ccdc43-003 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 602 bp
GAACAAATCGCCGGGGAGTTTGAAAACTGGCTGAATGAGC
GGCTGGACTCGCTTGAAGTTGACCGAGAAGTTTACGGAGC
TTATATACTTGGGGTGCTTCAGGAGGAGGAGAGCGATGAA
GAGCAAAAGGACGCTCTTCAAGGCATTCTGTCCGCTTTTC
TGGAAGAAGAGACGCTTGAGGAGGTTTGCCAAGAGATCTT
GAAACAGTGGACAGAGTGCTGTAGCAGATCTGCAGCAAAG
AGCGATCAGGCGGATGTGCTTTGCTTTGTTTTGTTTTAAG
CTGAAGTTCAGGCCATTGCTAGTCTGATAGAGAAGCAGGC
ACAGATTGTGGTCAAACAGAAGGAGGTGTCAGAAGATGCC
AAGAAGAGGAAAGAGGCTGTTCTTGCTCAATATGCCAATG
TCACAGACGACGAAGATGAAGCTGAAGAGGAGGAGCAAGT
CCCAGTGGGGATACCCAGTGACAAATCCCTGTTCAAAAAC
ACCAATGTGGAGGATGTTTTGAATCGCCGCAAACTGCAGC
GTGACCAGGCCAAGGAAGATGCACAGAAGAAGAAAGAGCA
GGACAAGATGCAACGTGAAAAAGACAAACTGTCCAAGCAG
GA

ccdc43 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ccdc43-201 (1) 2260
aberrant processed transcript ccdc43-202 602
mRNA ccdc43-203 (1) 985
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccdc43-202 Contained in:

OTHER ccdc43-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036427 (1)
  • Ensembl_Trans:ENSDART00000145148 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CD284211 (1) 602 bp
    CITATIONS (2)