Transcript

ccdc43-202

ID
ZDB-TSCRIPT-090929-16911
Name
ccdc43-202
Previous Names
  • ccdc43-003
Transcript Type
aberrant processed transcript
Annotation Status
nonsense mediated decay
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036427 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036427|OTTDARG00000027179|ZDB-GENE-040426-1587 ccdc43|OTTDARP00000029231 ccdc43-003 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 602 bp
GAACAAATCGCCGGGGAGTTTGAAAACTGGCTGAATGAGC
GGCTGGACTCGCTTGAAGTTGACCGAGAAGTTTACGGAGC
TTATATACTTGGGGTGCTTCAGGAGGAGGAGAGCGATGAA
GAGCAAAAGGACGCTCTTCAAGGCATTCTGTCCGCTTTTC
TGGAAGAAGAGACGCTTGAGGAGGTTTGCCAAGAGATCTT
GAAACAGTGGACAGAGTGCTGTAGCAGATCTGCAGCAAAG
AGCGATCAGGCGGATGTGCTTTGCTTTGTTTTGTTTTAAG
CTGAAGTTCAGGCCATTGCTAGTCTGATAGAGAAGCAGGC
ACAGATTGTGGTCAAACAGAAGGAGGTGTCAGAAGATGCC
AAGAAGAGGAAAGAGGCTGTTCTTGCTCAATATGCCAATG
TCACAGACGACGAAGATGAAGCTGAAGAGGAGGAGCAAGT
CCCAGTGGGGATACCCAGTGACAAATCCCTGTTCAAAAAC
ACCAATGTGGAGGATGTTTTGAATCGCCGCAAACTGCAGC
GTGACCAGGCCAAGGAAGATGCACAGAAGAAGAAAGAGCA
GGACAAGATGCAACGTGAAAAAGACAAACTGTCCAAGCAG
GA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations