Transcript

ccdc43-201

ID
ZDB-TSCRIPT-090929-16909
Name
ccdc43-201
Previous Names
  • ccdc43-001
Transcript Type
mRNA
Annotation Status
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036425 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036425|OTTDARG00000027179|ZDB-GENE-040426-1587 ccdc43|OTTDARP00000029229 ccdc43-001 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 2260 bp
GTGCGGACACCCCAACTCACTCTCAGGACCCCAGCCAGGG
AAGATGGCGGCGCCCGAACAAATCGCCGGGGAGTTTGAAA
ACTGGCTGAATGAGCGGCTGGACTCGCTTGAAGTTGACCG
AGAAGTTTACGGAGCTTATATACTTGGGGTGCTTCAGGAG
GAGGAGAGCGATGAAGAGCAAAAGGACGCTCTTCAAGGCA
TTCTGTCCGCTTTTCTGGAAGAAGAGACGCTTGAGGAGGT
TTGCCAAGAGATCTTGAAACAGTGGACAGAGTGCTGTAGC
AGATCTGCAGCAAAGAGCGATCAGGCGGATGCTGAAGTTC
AGGCCATTGCTAGTCTGATAGAGAAGCAGGCACAGATTGT
GGTCAAACAGAAGGAGGTGTCAGAAGATGCCAAGAAGAGG
AAAGAGGCTGTTCTTGCTCAATATGCCAATGTCACAGACG
ACGAAGATGAAGCTGAAGAGGAGGAGCAAGTCCCAGTGGG
GATACCCAGTGACAAATCCCTGTTCAAAAACACCAATGTG
GAGGATGTTTTGAATCGCCGCAAACTGCAGCGTGACCAGG
CCAAGGAAGATGCACAGAAGAAGAAAGAGCAGGACAAGAT
GCAACGTGAAAAAGACAAACTGTCCAAGCAGGAGCGCAAG
GACAAAGAGAAGAAACGCACACAGAAGGGAGAGCGCAAGA
GATAGAATATAGACGCAGAGGAAAACTGCAGGAAAGCTTT
TGTAGACTGTATAAAACCAAGGTTATTTTATCTAGAGGAG
AAAACTACGATGAGCAAACAGTGTCCCAACTCATAATGTT
ATAACGTATGCATCCATATTTAGTTTTGTATCTGAAATTG
TTTATTGTTTGATAATATAGGGCCTAATGAGCTACTCTAT
TGGCTTGTACAATAACCTATAACAGTCCAGCAAACAGCGA
AAAATTTGCCATAACCCTTATTCAATATTTACAGGTGCTA
ACTGCTATTTGTTATGGTTATGAACCCACAACACTTCCAT
TCATCATAGGAATGTAGATGATATATATCAAACCTGGGAG
ATTGATGTCCCTACAGTGAATTAAAACCCTGAAGCTTTAT
AAAGTTTGTAACAAAAATTCATATGAATCAAACTCTTCAG
AGGAGACATAATTACTTGCTAGCTTAAATTTAGGATTTAT
TATTACAACAACAACTGCTTGACCCACAAGAACAAACCTC
ATGGGTTCTTGCAAACATGATTGAGCTTCCGTGACCAAAT
TTAAATGCAGTATTTGTAAATGAATGAAAGCTTCAGTTTA
AGTCTGTTAATTATATGAAGTGACTGTGACCAATACAGAT
TTCACATTTCATCTCATTTTGAAGAGTTAAGAGTTTTGGT
TGAACAGATTTGCAGTGGATGGACAGAAATCCTCATTTGC
ATTCTAAATATTAACAATTTGTTACATATTGTAGATGAGT
AAATATATCATTTGAATTTTTTGATAAACTAACCCTTTAA
TGACAAAATCTCTAGCAGATCAAAAACATGTTCAAGTCAC
ATTTTAACCCGACATCTAAAATAATATTTAGCTTTATGAA
CATTTTACCATAAATCTCACTACTGCAGTGCTTGGCCTAA
GTTTTAATTTTATTTGTTAAAATGTTTATGGTGTAAAGAT
GTGACTTTTACATGTTTTCTGTAAGATTCACTCTTAAATT
GTTACCAGCAGATAATCAACACATTGTCTAAAATCTCTTT
ATTATTGCCCTGTGTTTTTTTTTAAATAGTCAGTGAACAT
GTATCTCTCTCTCTCCATTTAATACATGCTAACTCAAGAT
ACAAAGATATATTTATTGAGCTCACAAGCTTTTTCACAAT
AACATAAAACCAATAGAAGCCTTCTTGTTGTGTAGCAATA
TATGGAGAGGGCTAAGAGACGACCCAAAGACATAATCACA
ACTGCTAATCATTGCTAAATGGGGACATGTGTAGTTTGTT
TAAAGTTCATTGGTGTCAACAAACAGCTCTTGTTAGACAT
TTCTGTATTTTTGTTATAGGGCAGTGAACTTCTATAAGGG
TATGTTTGTGTGCATATATATGAATTGACAACTGTTTGTA
TGAAGCTGCTACATTTTGTGCCAATACCTTGTAGACTGCC
TTTACATATACTACAATGGGCTGCACTGTAGGCAAAGTGA
TATCTCTTAAACTTGTCTAGTAGCTTATACGATCAAGTGG
TTTAAGATTTTTACTATCAGAACTTCGATATTTAACATTT
TGTATGCTAAAACATCCGAA

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations