header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16909
Transcript Name: ccdc43-201
Previous Name: ccdc43-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036425 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036425|OTTDARG00000027179|ZDB-GENE-040426-1587 ccdc43|OTTDARP00000029229 ccdc43-001 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 2260 bp
GTGCGGACACCCCAACTCACTCTCAGGACCCCAGCCAGGG
AAGATGGCGGCGCCCGAACAAATCGCCGGGGAGTTTGAAA
ACTGGCTGAATGAGCGGCTGGACTCGCTTGAAGTTGACCG
AGAAGTTTACGGAGCTTATATACTTGGGGTGCTTCAGGAG
GAGGAGAGCGATGAAGAGCAAAAGGACGCTCTTCAAGGCA
TTCTGTCCGCTTTTCTGGAAGAAGAGACGCTTGAGGAGGT
TTGCCAAGAGATCTTGAAACAGTGGACAGAGTGCTGTAGC
AGATCTGCAGCAAAGAGCGATCAGGCGGATGCTGAAGTTC
AGGCCATTGCTAGTCTGATAGAGAAGCAGGCACAGATTGT
GGTCAAACAGAAGGAGGTGTCAGAAGATGCCAAGAAGAGG
AAAGAGGCTGTTCTTGCTCAATATGCCAATGTCACAGACG
ACGAAGATGAAGCTGAAGAGGAGGAGCAAGTCCCAGTGGG
GATACCCAGTGACAAATCCCTGTTCAAAAACACCAATGTG
GAGGATGTTTTGAATCGCCGCAAACTGCAGCGTGACCAGG
CCAAGGAAGATGCACAGAAGAAGAAAGAGCAGGACAAGAT
GCAACGTGAAAAAGACAAACTGTCCAAGCAGGAGCGCAAG
GACAAAGAGAAGAAACGCACACAGAAGGGAGAGCGCAAGA
GATAGAATATAGACGCAGAGGAAAACTGCAGGAAAGCTTT
TGTAGACTGTATAAAACCAAGGTTATTTTATCTAGAGGAG
AAAACTACGATGAGCAAACAGTGTCCCAACTCATAATGTT
ATAACGTATGCATCCATATTTAGTTTTGTATCTGAAATTG
TTTATTGTTTGATAATATAGGGCCTAATGAGCTACTCTAT
TGGCTTGTACAATAACCTATAACAGTCCAGCAAACAGCGA
AAAATTTGCCATAACCCTTATTCAATATTTACAGGTGCTA
ACTGCTATTTGTTATGGTTATGAACCCACAACACTTCCAT
TCATCATAGGAATGTAGATGATATATATCAAACCTGGGAG
ATTGATGTCCCTACAGTGAATTAAAACCCTGAAGCTTTAT
AAAGTTTGTAACAAAAATTCATATGAATCAAACTCTTCAG
AGGAGACATAATTACTTGCTAGCTTAAATTTAGGATTTAT
TATTACAACAACAACTGCTTGACCCACAAGAACAAACCTC
ATGGGTTCTTGCAAACATGATTGAGCTTCCGTGACCAAAT
TTAAATGCAGTATTTGTAAATGAATGAAAGCTTCAGTTTA
AGTCTGTTAATTATATGAAGTGACTGTGACCAATACAGAT
TTCACATTTCATCTCATTTTGAAGAGTTAAGAGTTTTGGT
TGAACAGATTTGCAGTGGATGGACAGAAATCCTCATTTGC
ATTCTAAATATTAACAATTTGTTACATATTGTAGATGAGT
AAATATATCATTTGAATTTTTTGATAAACTAACCCTTTAA
TGACAAAATCTCTAGCAGATCAAAAACATGTTCAAGTCAC
ATTTTAACCCGACATCTAAAATAATATTTAGCTTTATGAA
CATTTTACCATAAATCTCACTACTGCAGTGCTTGGCCTAA
GTTTTAATTTTATTTGTTAAAATGTTTATGGTGTAAAGAT
GTGACTTTTACATGTTTTCTGTAAGATTCACTCTTAAATT
GTTACCAGCAGATAATCAACACATTGTCTAAAATCTCTTT
ATTATTGCCCTGTGTTTTTTTTTAAATAGTCAGTGAACAT
GTATCTCTCTCTCTCCATTTAATACATGCTAACTCAAGAT
ACAAAGATATATTTATTGAGCTCACAAGCTTTTTCACAAT
AACATAAAACCAATAGAAGCCTTCTTGTTGTGTAGCAATA
TATGGAGAGGGCTAAGAGACGACCCAAAGACATAATCACA
ACTGCTAATCATTGCTAAATGGGGACATGTGTAGTTTGTT
TAAAGTTCATTGGTGTCAACAAACAGCTCTTGTTAGACAT
TTCTGTATTTTTGTTATAGGGCAGTGAACTTCTATAAGGG
TATGTTTGTGTGCATATATATGAATTGACAACTGTTTGTA
TGAAGCTGCTACATTTTGTGCCAATACCTTGTAGACTGCC
TTTACATATACTACAATGGGCTGCACTGTAGGCAAAGTGA
TATCTCTTAAACTTGTCTAGTAGCTTATACGATCAAGTGG
TTTAAGATTTTTACTATCAGAACTTCGATATTTAACATTT
TGTATGCTAAAACATCCGAA

ccdc43 TRANSCRIPTS
Type Name Length (bp) Analysis
mRNA ccdc43-201 2260
aberrant processed transcript ccdc43-202 (1) 602
mRNA ccdc43-203 (1) 985
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccdc43-201 Contained in:

OTHER ccdc43-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036425 (1)
  • Ensembl_Trans:ENSDART00000076640 (1)
  • PROTEIN PRODUCTS No links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC057502 (1) 2301 bp
    GenBank:CN023012 (1) 876 bp
    CITATIONS (2)