header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16908
Transcript Name: fzd2-201
Previous Name: fzd2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036424 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036424|OTTDARG00000027178|ZDB-GENE-990415-224 fzd2|OTTDARP00000029228 fzd2-001 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 2440 bp
CAAAGGGGGAAAAGTCATGCAGTCGCTCCTACGCGCAACA
GATACTCCTCGGAAAGTATGCGATTTACACTAGTTTGTGA
GTTTATCCAAACTTTTTGTTTTCGAAGAATAGATGATATG
TCGGGAAAAGCATAGTTTGCCGGACTCATTTTGTATCAAG
AGAAAGTTGAGCGGAACTTTTCGAGACAATGCAGGCGAGT
GGAAGTGTGTGTGTGTTTTTGGCACTGTTACTGCCGTGCT
GTTTCGTGGCGTCTGGACAGCATCAAGGAGATAATGGCAT
AGCGGTCCCTGATCACGGCTTCTGCCAGCCCATAACTATC
CCTCTGTGTACGGACATCGCTTACAATCAAACCATAATGC
CAAATCTGGTGGGACACTACAACCAAGATGATGCCGGGCT
TGAGGTCCATCAGTTTTACCCGCTTGTCAAGGTACAGTGC
TCACCCGAGCTCAAATTCTTCCTGTGCTCCATGTATGCTC
CAGTGTGCACAGTTTTAGAGAAAGCCATCCCACCATGCCG
CTCCATTTGTGAGAGGGCGAAGCAAGGCTGTGAGGTCCTC
ATGAACAAGTTTGGCTTTCAGTGGCCAGAGGCGCTCAGAT
GTGAGCATTTCCCAGTTCTGGGTGACGGACACATCTGTGT
GGGCCAGAATGATTCCATGGCCACCGTGTCACCCGTTCAC
ATGCCCATTCCAGGAACACCAAGCGTTCAGCTCTACTCCA
CACCGGATAAACCATTTCGCTGCCCTTCCACACTCAAAGT
GCCAGCCTACCTCAGCTATAAGTTCCTGGGTGAGCCAGAT
TGTGGTGCCCCCTGCGAGTCCTCCAGAACACACAGGGCCT
ACATGTTCTTCACAGACCAGGAGATTGAGTTTGCCCGCAT
TTGGATCCTCATCTGGTCATCGCTCTGCTGTGCGTCCACT
TTATTCACTGTAACCACATATATAGTGGACATGCAGCGTT
TTAAATACCCTGAGCGTCCTATTATATTTCTGTCTGGCTG
CTACACCATGGTGTCCATTGCATATATCGCTGGCTACTTC
CTCGGGGACAAGGTTGTGTGCAATGAGAGCTTTTTTCCTG
ACAGCTACAAAACCATTGTTCAAGGTACAAAGAAGGAAGG
ATGTACGATTTTGTTCATGATGCTGTATTTCTTCAGTATG
GCTTCTTCGATCTGGTGGGTCATCCTGTCACTCACTTGGT
TCCTGGCGGCGGGTATGAAATGGGGCCATGAGGCTATTGA
AGCCAATTCACAATACTTTCACCTGGCTGCCTGGGCCGTT
CCAGCCGTAAAGACTATTAGCATCCTTGCAATGGGGCAGA
TCGATGGAGACGTGCTAAGCGGAGTTTGCTTTGTGGGCCT
GAATAATTCAGATGCCTTGCGGGGCTTTATTTTGGCTCCT
CTTTTCCTCTACCTCTTCATTGGCACCTCATTTCTGCTTG
CAGGCTTCGTGTCGCTCTTCCGCATCCGAACCATCATGAA
ACATGATGGCACCAAGACTGAAAAGCTGGAGCGATTGATG
GTCCGCATAGGTGTCTTTTCGGTTCTCTACACTGTCCCAG
CCACCATCGTCATTGCCTGCTTTTTTTATGAGCAGGCCTT
TAGGCAGCAGTGGGAGAAGAGCTGGATCAGTATGAACTGT
AAGAGCCTGGCCATCCCCTGTCCCATGCAGCCCGCTCCTC
ACATGACCCCCGACTTCACCGTCTTCATGATCAAGTACCT
CATGACCCTCATTGTAGGGATCACTTCAGGATTCTGGATC
TGGTCGGGAAAGACACTGCACTCTTGGCAGAAGTTCTATG
TGCGTTTGACCAGTGCTGGACAAGGAGAAACCACTGTTTG
AAACGAGACATTGTGATCCACAATTTCATGCATTATGACT
TTAGAAATACAAAAAGTGCCTTTGATTGTCAGTATTTTGA
AAGCAATTATTCATGTCTATTTCTGAGGCTGCCGAGAAAG
AGAAATGGGACATAAACCACTTGGCTTCACCAAATAAACA
TGGCCCATTTGATACCAAGTGCATAAATGTGTTCCTCCCC
ATTCTACTGCCCCCCTGGGTTTTTTTCTCATAAGCTGCTG
GCCATAAAAACTCAACTTGGAAAGTGAGATACCAGCTGGG
AATTCATCAAACGACAGAGCAAAGCGAGCCGTGGGGGGAG
GAGAGCTTTAACGGCAGGCAGTTGTGCTTAATGTAATTAA
AACACACATAATACCTAATATGTACATAATACATATGTAC
ATATGTATTATGTACATATGTACATAATATTTGTAAAAAT
CTGTATTTAACCTTTATTATATATATTTGTATTTAAGCAA
TTGTACCTTTTTATGTTTCAAAGTTTGGTACTCTTTAGAA
TCTGAATTTTGTAGCCACTCTCTCTCATTTGCTCTGTACT
TAAGTTTTTCTCTGTTTTGAATTAAAATTGCTGTACAGAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
fzd2-201 Contained in:
OTHER fzd2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036424 (1)
  • Ensembl_Trans:ENSDART00000076636 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC056524 (1) 2455bp
    GenBank:AY033592 (1) 2360bp
    CITATIONS (2)