header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-16907
Transcript Name: ccdc47-201
Previous Name: ccdc47-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036423 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036423|OTTDARG00000027177|ZDB-GENE-040912-15 ccdc47|OTTDARP00000029227 ccdc47-001 LG_ CU062431.6 Danio rerio protein_coding KNOWN, 2461 bp
GGCTCGCGCGCAAAGCATTGTGGGTAGAGTGATTCGGTCA
GATGACCCCCTTGCCTCTCCTGTGAGGGGTACAGCTGCTG
TCACACACTGAAGGTAACACCGGCGGTTACAGGTTGAGCC
ATGAGGCACCTGGTCTTCCTCCTCCTCCCAGCCCTGCTCC
TGCTGTTGGCCCTGCCAGACACTAGGGGGCGCTACAACGA
CGACTTTGATGACGGTGAGGACATCGCTGAATTTGATGAC
AATGACTTTGCAGAGTTTGAGGATGTCAGCGAGGATCCAG
CTGTGGATGTGGAGAAAGAACCACCACCTCGACCAGCTCC
TTCGTCTACCCCTGTAGAGGATGACGAAGACGAGGCCACG
GTGGAGAACGAAGACGGCCAGGATGAGTTTGAAGATACAG
ATGCACAGGATCAAGACATGTACAACAAATATGACACTGA
CGAGTTTGAAGGCTACGAGAAGTCTAATCCTTCATTCAAA
GACACTCTTATATACAGAGAGGTCCCAGCACACTTGCAGA
ACAGCTGGGAGAGTTATTACATGGAAATCTTGATGGTCAC
TGGACTTCTTGCATACATTATGAACTACATAATTGGCAAA
AATAAGAACAGCAGACTCGCACAGGCCTGGTTTAATTCCC
ACAGAGAACTTCTGGAGAGCAACTTTGCCCTTGTTGGTGA
TGATGGTACCAGTAAGGAAGCCACCAGTACAGGGAAGCTA
AACCAGGAGAACGAGCACATCTACAACTTATGGTGTTCGG
GACGGGTCTGCTGTGAGGGGATGCTCATTCAGCTGAAGTT
TCTGAAAAGACAGGACCTGCTGAATGTGCTGGCCAGGATG
ATGAGACCAACCTGTGATCAAGTGCAAGTTAAAGTGACTC
TAAATGATGAGGATATGGACACCTTTGTGTTTGCTGTGGG
AAGTCGGAAGGCCATGGCACGGATGCAGAAGGAGATGCAG
GACCTGAGTGAGTTCTGTGGCGATAAGCCCAAATCAGGGG
CAAAATATGGCATCCCTGACTCTCTGACCATTTTATCAGA
GATGGGAGAGGTCACGGATGGAGTGATGGACAACAAGATG
GTACATTATCTCACCAGTCATGCTGATAAGATTGAGTCCA
TCCATTTTTCGGACCAATTCTCTGGTCCAAAAGTTATGCA
AGAGGAAGGTCAGCCCTTAAAGCTGCCCGAGACCAAGAAA
ACACTGCTGTTTACATTTAACGTGCCTGGGATGGGTAACA
CGTCTCCCAAAGATATGGACAGTCTGCTGCCTCTGATGAA
CATGGTGATTTACAGCATCGACAAGGTCAAGAAGCTCCGC
CTCAACAGAGAAGGGAAACAGAAAGCCGACAGAAATCGTG
CTCGCGTGGAGGAGAACTTCCTGAAACAGACTCATGCTCA
GCGCCAGGAGGCCGCTCAAACACGCCGTGAAGAGAAGAAA
AGAGCTGAGAAGGAAAGGATCATGAATGAGGAGGATCCTG
AGAGACAGCGTCGCTTGGAGGAAGCCGCCCAGCGACGGGA
ACAGAAGAAGATGGAGAAGAAGCAGATGAAAATGAAGCAG
ATCAAAGTGAAAGCCATGTGAGACGGATACAAACACGCAT
ACACACACACACACACACACACACACATACACTCATATTC
ATTAGAGACAGAATCTACTACTTCCACACCTGCTATTGTA
CACTTTTCTTCATGAATGTGCATGCCATTCGATTGGCTGC
TGTTGCACCCATAGAAACGCTCTGTTTAATAGGAAGATTG
GCTGTTGAGGAGTGAATCTGATCTTTAAAAGACAACTGTA
TTGGAGATGGTCTGTTCAAACAGCTTGAACTTGTTTCATT
GTAGCAGCCATTTCAATCACAAGTTTTCGACATAACTGCA
TGACTGTTTTTATTGCAATAGGGTCAAGAATGTTGCTTTT
TGTGGGCTTTGCTGTAATAAACTGGACTTTTTAGGCCTCA
TCAAACCAACTTTTCCAATTCAGATGTCTCTCGGAGTTCA
GTGTTGACCTTCCAAAGCTTTATCGTGCTTTAGAGATTTC
ACTTCATCTCGTGAAAGTTTCAGCTATGCTTCTTTTAAAA
GTGAAATCAGGGAGTGTTTTTAAAAGGAAATGGGTGGGTA
AGAAAGCTTTTTGTACTACAGTGCTTCCTTAGCCATATTT
CTATGAGTCCATGATCGCGAGTGTTTTATAGATGAGTAAA
AGGCACATTATCACTGTCTTTCAATCTCTTTCTGTTTTTT
TTATGAGCAAAGGCCCACTGTGAATTGTCACTGTCGAGGC
AGCACAAACTCCTCCTTTATACGTATTTAATAGAGGTGAA
TTTTTAATTTATCGTTAAGTTAATAGTCAATCAGAGCATC
CAAGAGCTTATATCATGTTTATGAGTGAACATTGACTGTA
ACATTTTTTCTGTAACATTTGTTAATGAGACGCTAACTAA
ATAAAACATTCATTAAAATGA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
ccdc47-201 Contained in:

Genome Resources: Vega_Trans:OTTDART00000036423 (1),  Ensembl_Trans:ENSDART00000051542 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:BC081592 (1) 2424 bp
GenBank:BC058322 (1) 1948 bp
GenBank:CB359351 (1) 393 bp
CITATIONS (2)