header logo image header logo text
Downloads Login
Research
General Information
ZIRC
ZFIN ID: ZDB-TSCRIPT-090929-1683
Transcript Name: hgfa-202
Previous Name: hgfa-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000010304 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000010304|OTTDARG00000008978|ZDB-GENE-041014-2 hgfa|OTTDARP00000008876 DKEY-146J3.2-001 LG_ BX897731.7 Danio rerio protein_coding NOVEL, 2249 bp
GGTAGTGTGTGCTTGAGAAAGAGAGAGAGAGTGAGAGAGC
AGTCGCTGCGGTTTGATCCTGTTCATCCTTCACACCAGCA
GCAGCAGCAGCATCAACTCGGACTTTATAGACTCTCCATC
CCACAGCCTGGAATATCAAACCGAGAAACATGAGATCGGA
CATTATGTGGATGTATCAAGCTCTTCTCTTTGTCGTACTG
ACCGTGAATGTGGATTGCAGAAAACAGACATTGCAGAGGT
ATCAGAAAAGTGAAAACAGCCGACTGCTTTGTACAGACTG
TCCAGAATCCCCTCGAATTAGGAACCTGTCGCTGGAGGAA
TGCGCACGCAAATGTAGCAAGAGCAAGAAGTCCTGCAGGG
CATTCTACTTTGACCACATAAACAGGAAATGTCACTTTCT
TCCTTTTGACCGTTTCTCCGAAGGCGCGAAGAGAGAGCGA
AAACCCAGTTGTGACCTTTACGAGAAGAAAGACTATGTGA
GGGAGTGCATCATTGGGTCAGGTGTCAACTACAAGGGGAG
AAGGTCATTCACAAAGACTGGAATTACGTGCCAATCCTGG
AATATGTCCGTCCCACATGAGCACAATTTTAAGCCTACCA
GACACAAAAAGTCTGACCTACGTCAGAACTTTTGCCGAAA
TCCAGACAATGATCCAAATGGGCCCTGGTGCTTCACTGAA
CTCACTGAGACCCGGCACCAGGATTGTGGACTGCCTCAGT
GTTCAGATGTGGAGTGTATGAAATGTAATGGGGAAACCTA
CAGAGGGCCCATGGATCATACAGAGAGTGGGAAAGAGTGC
CAGAGATGGGACTCGCAGAAACCTCATAAACACACCTACC
AGCCTCACAGGCATGTAGGTAAAGGTCTGGATGACAACTT
CTGCCGCAATCCCAATAATGATGTTCGTCCGTGGTGTTAC
ACGATGGACAAAAACACCCCTTGGGAGTACTGTAACATCA
GTGTGTGTGACTCAGATAGCGATGTGGAAGTGGAGGTGAC
CAGCTCTTGTTTTCGGGGTCAAGGAGAGGGCTACAGGGGT
ACAGTCAACGTGACCCCTGCAGGTGTGACCTGTCAACGCT
GGGACGCTCTCTCTCCTCACATCCATTCATACACTCCGCA
CAACTATAAATGCAAGGATCTGAGGGAGAACTATTGCAGA
AATCCTGATGGCTCTGAAATTCCCTGGTGTTTCACCACAG
ACGCAAAAGTGCGCAAAGCTTTCTGTACCAACATTCCCAG
ATGCGAATCAGAGAGCTCTGACAGCACAGAATGTTATGAA
GACAACGGAGAGAGTTATCGTGGCAATTTGTCGAAAACGA
GATCTGGTATTCCTTGCGGACTCTGGTCTGACCACACATT
CAGGAGAGACACCCGGTCAGCGAAGGCCAGCGCGGGTTTA
GAGTTGAACTTGTGCAGGAATCCAGACAGAGATAAGCACG
GGCCGTGGTGCTACACGTCCAACTCCTCCATTCCCTGGGA
CTACTGCGGACTGGAGCGCTGTGGAGGACCAAAACCATCT
TGCTTTATACATAAAACCACACGGATTGTTGGGGGAATGC
GAGTGCAGCGGGCAGAGGATGGAAGTTGGGTGGTCAGCAT
TCAGAAAGGGAACAGACACTGGTGCGGTGGCTCTCTCATC
AGAGAAGAATGGGTTCTCACTGATCAACAGTGCTTCTCCA
CCTGCGTTCCTGACCTCTCCGAGTACACCGTGCAGGTGGG
GCTTCTTCATCTCAATGCATCCGCCGGCACGCAGGCTCTC
CGAATCGCACATGTGGTCTGCGGGCCCGAGGGATCCAACT
TGGCCCTGCTCAAACTCACAACGCCTGCCCCTCTCTCTGA
GCATGTGCGAACTGTTCAGCTTCCGGTCGCTGGCTGTGCT
GTTGCAGAAGGCACTCTGTGTCTCATGTATGGATGGGGAG
ACACTAAAGGACACGAGGGCAGTCTGAAGATGGTGGGACT
TCCAATTGTCAGCAACAAGAGGTGTTCACAAAGCCACAAT
GGCATCCTGCCCATCACCGAGACCAAAATCTGTGCTGGAG
GCAAGAGAGATCAGGGCGTTTGTGAGAAAGACTACGGTGG
CCCTTTGGTGTGCCAGGAAGGAGAGAGCAAAGTGATAGTT
GGCGTCAGCATCAACGGCCGTGGTTGTGCAGTAGCGAGAC
GTCCTGCTGTCTTCGTCAACGTGGCCTTCTACTCTGAATG
GATCCGCAAGGTCTTCAAGTACTATTCAGACATGGAAATA
AGTTACTAG

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
hgfa-202 Contained in:
OTHER hgfa-202 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000010304 (1)
  • Ensembl_Trans:ENSDART00000100952 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CK682599 (1) 516bp
    CITATIONS (2)