ZFIN ID: ZDB-TSCRIPT-090929-16826
Transcript Name: gipc1-201
Previous Name: gipc1-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036327 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036327|OTTDARG00000027120|ZDB-GENE-060726-1 gipc1|OTTDARP00000029151 gipc1-001 LG_ BX649515.7 Danio rerio protein_coding KNOWN, 1296 bp
GAGGAAGAAGTGTGTGTTCTGTTGAGTGATGTGATGTCCG
CCCTCCTCGCACACACTACAACACTCCCTAAACTCCTGCA
TTAACACTCCTCAACAATCATCCCCTGTAATGAACTTACT
ATAAGCTCGGCGTCCAGCGGTTCATGGTTTTCTCCTTGCC
AGTGTTAGTTTGATCTGGAGATTTGAATGGGTTGAATTGC
AGAGATTTCTCCTTCGATTTGGGAACATAAAGAACGGTAT
TAAAGCTTGTGCACACACCTTTTGCATTAAAGACAGCAGT
GCCCAAAAATGCCACTTGGATTGGGACGCAGAAAGAAGGC
GTCTCCGCTGGTGGAGAACGAGGAGGCTGAACCCATCCGG
GCTGGACTGAACGTCTCAGGGTTGGATGGTCTGGATGGTG
GCAGGGTTGGCTTGGGTGAAGGAGCTGCCCATGAGGGTTT
ACCACCTCCACCCACCAGTCTGCGCCCACGACTGATCTTC
CACACACAGCTGGCTCACGGCAGCCCCACAGGACGTATCG
AGGGCTTCAGTAACGTGCGTGAGCTTTATGCTAAGATAGG
AGAGGCCTTTGGGATTCCTCCAACAGAGGTGATGTTTTGC
ACACTGAACACTCACAAAGTGGATATGGACAAGCTTTTGG
GTGGCCAGATCGGACTGGAGGACTTTATATTCGCTCATGT
GAAGGGCCAAAGGAAAGAGGTGGAGGTCTTTAAAGGAGAG
GATGCACTGGGGCTCACCATCACTGATAATGGAGCTGGCT
ATGCTTTTATTAAGAGAATAAGAGAAGGCAGTATTATTCA
CCAGATCCAAGTTATCAATGTGGGCGACATGATTGAGTCA
ATCAACGGGCAAATACTCATTGGCTGTCGCCATTATGAGG
TCGCCAAAATGCTGAAGGAGCTGCCTAAAGGGAAAACTTT
TTTCCTGAAGATGGTGGAACCCTTAAAGGCATTTGACATG
ATCAGTCAGCGTTCAGGAAGCAGGTCTGGCTCTGCACAGT
TAGGAACGGGCAGAGGAACTTTGCGTCTGAGGTCTAAAGG
ACCGGCCACTGTAGAGGAGCTGCCTTCAGCTTTTGAAGAA
AAAGCCATTGAGAAAGTTGATGATCTCCTGGAGAGCTACA
TGGGCATCAGAGACAGTGAACTTGCTGCGACAATGGTGGA
GCTTGGCAAGGATAAAAAGAACCCAGATGAGTTTGCTGAA
GCTTTGGACGAGACTCTGGGCGATTTTGCTTTTCCAGATG
AGTTTGTGTTTGATGTGTGGGGTGCCATAGGCGACGCAAA
GGTCGGTCGCGTGTAA

GBrowse:
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
gipc1-201 Contained in:
[BAC] CH211-120F15 (1)

Genome Resources: Vega_Trans:OTTDART00000036327 (1),  Ensembl_Trans:ENSDART00000167173 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (bp/aa) Analysis
RNA GenBank:AY690668 (1) 1008 bp
GenBank:AY989813 (1) 1008 bp
GenBank:DN857003 (1) 740 bp
GenBank:BI840407 (1) 616 bp
GenBank:EB936288 (1) 413 bp
CITATIONS (2)