Transcript

rdh8a-002

ID
ZDB-TSCRIPT-090929-16820
Name
rdh8a-002
Previous Names
  • rdh8-002
  • ottdart00000036320
  • zfinnucl0000004576
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036320 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036320|OTTDARG00000027116|ZDB-GENE-021115-3 rdh8a|no_translation rdh8-002 LG_none BX004869.13,BX544872.8 Danio rerio protein_coding KNOWN, 573 bp
CGGCACTGTGCGCATGATAAAAGAGGTCATGCCGGACATG
AAGAAGCGCCAAGCGGGACACATTATCGTCATGAGCAGCG
TCATGGGCCTGCAGGGTGTGGTGTTCAATGACGTCTACAC
CGCCTCAAAGTTTGCCATAGAGGGCTTCTGCGAGAGCATG
GCTGTTCAGCTGCTCAAGTTTAATGTCAAATTGTCTCTGA
TAGAGCCAGGCCCGGTGCACACAGAGTTTGAAACCAAGAT
GATGGAAGAAGTAGCCAAGATGGAGTATCCTGGAGCAGAT
CCAGACACAGTCAGATACTTCAAGGATGTGTACGTCCCGT
CATCCATTGACATCTTTGAGGCAATGGGACAAACACCAGA
TGACATTGCTAAAGTATGTGCCACAATTTAACAGTAAACT
TTACACTGCACTTTAAACATTTAACACTAGAACCACCTGG
GTAACGTTTTTCTGTGGCTGTTTTTCCGATTTACAATAAT
TTAAAAACAGCATTTGGGATGGAAAAAGTCAGCTATATCT
GGCAACACTGTTGAGAATACATCAAACATCAAATAAAAAT
GCATATTTCTAAG

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations