ZFIN ID: ZDB-TSCRIPT-090929-16734
Transcript Name: tm9sf2-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status: retained intron
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036226 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036226|OTTDARG00000027070|ZDB-GENE-030131-6302 tm9sf2|no_translation tm9sf2-002 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 706 bp
TACGATGTGGAGGACAATCAGAAGTTCTGTAATCCTGGCT
TTCCCATTGGTTGCTATGTCACAGATACAGGACGGGCCAA
AGATGCCTGTGTGGTCAATGCTGACTTCAATGACAAAGAC
ACCTTCTACATCTTCAACCATGTGGACATAACAATTTTCT
ACCACAATGTGGAAAATGAGGTTGCTGGTGCCAGACTGGT
TGCAGCTAAGTTAGAGCCCAAAAGCTTTAAGCAGTCCAAC
GTAGACAAACCAGACTGCACAGGACCTCCCATGAGCCTGA
GCAACAAGTTCAATGGAGAAATCAGGATACCCTACACTTA
CTCTGTCAAGTTTCTGGAGGATAAGACAATTCGCTGGGCC
TCCAGATGGGATTACATTCTTGAGTCTATGCCACACACAA
ACATTCAGTGGTTCAGTATCATGAACTCTCTGGTCATCGT
ACTCTTCCTCTCTGGAATGGTCGCTATGATCATGCTTCGA
ACACTTCATAAAGATATCGCTCGATACAACCAGATGGACT
CTGTGGTGAGTTCCACTCTACAAGATTACATCATAATCTT
ATATGATCTGTATATATGTTTGTGTGACTGTTGTAGTTTA
TGCATTTTAGTACAGCCAACATTTTGTCTTTCAGGTGATT
GATCATATTTATGTATACATGTGTTTGAGTCTGTCTGTGG
TTAATCAGCATAATGGCAAAAGAATA

tm9sf2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tm9sf2-002 706
mRNA tm9sf2-201 (1) 3051
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tm9sf2-002 Contained in:
OTHER tm9sf2-002 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036226 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:CV483755 (1) 798bp
    CITATIONS (1)