ZFIN ID: ZDB-TSCRIPT-090929-16733
Transcript Name: tm9sf2-201
Previous Name: tm9sf2-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036225 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036225|OTTDARG00000027070|ZDB-GENE-030131-6302 tm9sf2|OTTDARP00000029072 tm9sf2-001 LG_ BX088652.6 Danio rerio protein_coding KNOWN, 3051 bp
GTCAGATGCTGCTACGCAGGCAGCGGTTACGCTAACGCTT
GTGCTTAGACATCACCAATGTCTAAATTTTGACACCCATA
TCTACATTTCACGCATGTAAATACATCTACAGATTACTTA
ATTAGTCGGTCGTGGCAAAATGGTCGAGTTCCACCGTGTC
CGTGTTGTATTTGTGTCGCTTTTCGTGTGCGGGTTGTTGC
GGGACGCGTTGAGTTTCTATCTTCCTGGTTTGGCCCCGGT
CAGCTTCTGTAAGAAAGAAGCGGGCGACAAAAACAGCGAA
GTCCCAGACTGCAAGTCAACCATTGAGCTCTTTGTGAACA
GGCTGGATTCTGTGGAGTCAGTTTTACCCTATGAATATAC
TGCGTTTGATTTTTGTGCTGAGCAACATGAGAAGCGACCA
TCTGAGAACTTGGGCCAGGTATTGTTTGGTGAGAGAATTG
AGCTGTCCCCATATAAGTTTTTGTTCCAGAATGATTTGCA
ATGCCAGTCCGTCTGCGTCAAGTCTTACAAAACACAAGAT
GCAGGTGATAAAGCCAAATTGGATTTCCTCAAGAAGGGAA
TGCTCCTCAATTACCAACACCACTGGATTGTTGATAATAT
GCCGGTGACCTGGTGTTACGATGTGGAGGACAATCAGAAG
TTCTGTAATCCTGGCTTTCCCATTGGTTGCTATGTCACAG
ATACAGGACGGGCCAAAGATGCCTGTGTGGTCAATGCTGA
CTTCAATGACAAAGACACCTTCTACATCTTCAACCATGTG
GACATAACAATTTTCTACCACAATGTGGAAAATGAGGTTG
CTGGTGCCAGACTGGTTGCAGCTAAGTTAGAGCCCAAAAG
CTTTAAGCAGTCCAACGTAGACAAACCAGACTGCACAGGA
CCTCCCATGAGCCTGAGCAACAAGTTCAATGGAGAAATCA
GGATACCCTACACTTACTCTGTCAAGTTTCTGGAGGATAA
GACAATTCGCTGGGCCTCCAGATGGGATTACATTCTTGAG
TCTATGCCACACACAAACATTCAGTGGTTCAGTATCATGA
ACTCTCTGGTCATCGTACTCTTCCTCTCTGGAATGGTCGC
TATGATCATGCTTCGAACACTTCATAAAGATATCGCTCGA
TACAACCAGATGGACTCTGTGGAGGATGCCCAGGAGGAAT
TTGGCTGGAAGCTGGTTCACGGAGATGTCTTCAGGCCGCC
TAGGAAAGGCATGCTGCTGTCTGTGTTCCTTGGTTCTGGG
ACTCAGATCTTCATCATGACCTTTGTCACTCTATTTTTTG
CCTGTTTGGGTTTCCTGTCACCTGCCAATCGCGGGGCTCT
GATGACGTGTGCAGTGGTGCTGTGGGTGCTCTTGGGTACT
CCAGCTGGTTATGTGGCTGCTCGCTACTACAAATCTTTCG
GTGGTGAGAAGTGGAAGACCAATGTTCTGTTGACAGCTTT
TCTCTGTCCAGGAGTGGTGTTTGCAGATTTCTTTGTGATG
AATCTCATTTTGTGGGGTGAGGGTTCATCCGCTGCCATGC
CCTTTGGCACTCTGGTTGCCATCCTGGCTCTGTGGTTTTG
CATATCAGTGCCCCTCACCTTTATCGGCGCGTACTTCGGT
TTCAAGAAAAGCGCCATTGAACATCCTGTGCGGACCAACC
AGATTCCAAGACAGATTCCAGAGCAGTCCTTCTATACTAA
ACCTCTTCCTGGCATTGTCATGGGAGGAATCCTGCCATTC
GGATGCATCTTCATCCAGCTGTTTTTCATTCTCAACAGCA
TCTGGTCTCACCAGATGTACTACATGTTTGGCTTTCTCTT
CCTGGTCTTTATCATCTTGGTCATCACCTGCTCTGAGGCC
ACCATTCTCCTCTGCTACTTCCACCTGTGTGCTGAGGACT
ATCACTGGCAGTGGCGTTCTTTCCTGACCAGCGGATTCAC
AGCTGTTTATTTCCTGGTCTATGCCATCCATTACTTCTTC
TCCAAGCTGCAGATCAGCGGACTTGCCAGCACCATTCTTT
ACTTTGGTTACACCATGATCATGGCGCTCATCTTCTTCCT
CTTCACAGGCACCATTGGATTCTTCGCTTGCTTTTGGTTT
GTCACCAAGATCTACAGCGTGGTCAAAGTGGATTAAATGA
AAGCAATCTCAGATGAGACTGAACTTCTCTTCTCCGCCCA
ATGTGAGATCCCAGAGGGAGGGACCTGAGCGCTGTTTATC
TTCTGTTGCCACGGCAACCCTTCTTTACATCAGCAACTCT
AAATCTACAAATTTAATTTACTTTGCTGTGTGTGCGTGTG
GGCGTGTGTACATTAGTAGTGCATATTCAACCAATTGGAA
GAACTCTACACATCTGCTTCTTTAGTTGGAACAGAATACA
GCAGATACACACATTGACCCTTATAACTCACATGGGTATT
TACGATTTGGAGTTGTCATTTGTAAATATTACTTACTTTA
TTCTTTGCTAACGTTCAAATGGAAGGGTAATGCATAAATC
GCAGAGAAAACTAGCTCCAGTCATTGAATCTTCAAGGTGT
CGGAAGTATGATTTTGTAAATATCTTCTTTTGTTTCTTAA
ATTCATCAAGCAAGAAAGTAGAAGTTGAAAGCCGAAGGAC
TTCATTCTTTGGGTTGATTTAAGAGTGAGGCTGTGTGAAT
TTTCTTTTTTTCCATCTTGTTGATACTGTACAATTACTGC
TTGCGTATACTTGTGTATAACCAGTGGGGGGAATGTCTAT
TTAACTTTTTTGTTTGGTCATTTTTTCTTTGTTTTCTGTT
TATGCCTCAACACTTTGTGTGCCTCATTATCACAGAGGAA
AATCAAGACTGGTAAAAACTGATTTGGGAAGATGTGAAGT
GCCCCGTCCATACACAGGGGTAACTGGAGTGAAATGATTT
CTTTTGTTTGTATATATGCACAGCGTTAAACGTGTGTCCA
GCATAAACTACATTAGCTTGGTTGGCTACTCGGTTTTGGT
TTTTGTCTTCTCTGATTTTGAGGTAATGAGATTACAAGAA
AAATGAAAAAAAAAAATTATTAGAAATAAAACCTTGTCTT
CAAAAATATAA

tm9sf2 TRANSCRIPTS
Type Name Length (bp) Analysis
ncRNA tm9sf2-002 (1) 706
mRNA tm9sf2-201 3051
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
tm9sf2-201 Contained in:
OTHER tm9sf2-201 TRANSCRIPT PAGES
  • Vega_Trans:OTTDART00000036225 (1)
  • Ensembl_Trans:ENSDART00000019743 (1)
  • PROTEIN PRODUCTSNo links to external site
    ZEBRAFISH SUPPORTING SEQUENCES
    Type Accession # Length (bp/aa) Analysis
    RNA GenBank:BC049137 (1) 3063bp
    GenBank:BC152673 (1) 3062bp
    GenBank:EV761144 (1) 960bp
    GenBank:BI840899 (1) 599bp
    GenBank:AL913598 (1) 539bp
    GenBank:AL913599 (1) 537bp
    GenBank:CK711790 (1) 521bp
    CITATIONS (2)