Transcript

si:dkey-32e23.4-002

ID
ZDB-TSCRIPT-090929-16663
Name
si:dkey-32e23.4-002
Previous Names
  • si:dkey-32e23.4-003
Transcript Type
ncRNA
Annotation Status
retained intron
Associated With Genes
Strain
TU
Non Reference Strain
Genome Resources
RNA Central
None
Note
None
Sequence
OTTDART00000036130 (1) [ Show ] (double-click sequence to select) [Download]
>tpe|OTTDART00000036130|OTTDARG00000027014|ZDB-GENE-081105-41 si:dkey-32e23.4|no_translation DKEY-32E23.4-002 LG_ CR855300.21 Danio rerio protein_coding NOVEL, 515 bp
GAGGAGGACCTTTTTACGGGAAGCCATGTTGTGTGGAAGG
ACACTGCTAAGAAGAAAAGGATATTAGAGGTGGACAGTCG
TTTAATTAACGCAGAGATGGAAACTCTGATTCCCATCATT
AACCGACTGCAGGAGGTCTTCCTCACAGTTGGAGCTGAGA
TCATCCAGCTTCCTCAGATCGTAGTCGTGGGGTCACAGAG
TAGTGGGAAGAGCTCAGTGTTGGAGAGTTTGGTCGGACGG
GATTTTCTGCCTCGAGGTTCAGGAATAGTGACGCGTCGCC
CTCTAGTGTTACAGCTGGTGAACGTGCCACCTCTGGAGGA
GAGACGGAAACAAGACAATGGTAACAACTCTAAAAAAATT
AAATTCTTATTATTAGTTTTAGACTTGACAAACAAAAATA
AGTGCAATTCAAGCTTTATGGATGTGCAATTCCAGCTTTA
TGGATGTGACATTTGCTGTAAAAACTTCAGAGATTTGCAT
ACACAGAACATTATATTGACACATCAGTTTATATT

Segment Relationships
Protein Products
No data available
Supporting Sequences
Citations