ZFIN ID: ZDB-TSCRIPT-090929-16662
Transcript Name: si:dkey-32e23.4-202
Previous Names: ottdart00000036129, si:dkey-32e23.4-001

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036129 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036129|OTTDARG00000027014|ZDB-GENE-081105-41 si:dkey-32e23.4|OTTDARP00000028991 DKEY-32E23.4-001 LG_ CR855300.21 Danio rerio protein_coding NOVEL, 3060 bp
CTGAGGATATTATCGCCTCTGTCATGTGATTTTCACATTT
TTCTGTTCTTTTAACCCCTGACTCATTCACACTTCCTCAA
AGCGTCACGTATAACGATCTACTTCCTTATCTCATATCTG
TTTTTCCTATGTAATATAATTTTACACAAATGTCCTAATT
AGGCTCGAAACTTTCTTTAAACTATAATGTTTCATGTAAT
TCCATAAGAGAAAATCCTTACCGTGCCGAATAACCCCACG
GATGAAATTGGGGTCCTGATGTTGGAAAGGGGCGTGGAGA
AGCTGCCGTGACATATTTGTGATTGATGGGTGTTTCGTCC
AATGAGCTAAGCGTATACGTGAACGTCAGCATTCTATTAG
CCAATCGAATTTCCTGTAGCTGACGCCCGACTCATCTTTG
ACAGCATACAGAGAAGCGAAACCTCAATATTGTCGGTCTT
CCTGTGATTGTAGGTTGTATTTTCCACATTTGCAGCATGA
CAGCGAGCGCTTTAACGCAGTGATTGTGTAATATTTCTGA
AGGCTCGATACGTCGCGATACGAGATGGAAACTCTGATTC
CCATCATTAACCGACTGCAGGAGGTCTTCCTCACAGTTGG
AGCTGAGATCATCCAGCTTCCTCAGATCGTAGTCGTGGGG
TCACAGAGTAGTGGGAAGAGCTCAGTGTTGGAGAGTTTGG
TCGGACGGGATTTTCTGCCTCGAGGTTCAGGAATAGTGAC
GCGTCGCCCTCTAGTGTTACAGCTGGTGAACGTGCCACCT
CTGGAGGAGAGACGGAAACAAGACAATGGAAATGGATCTA
AGCAAAACTCTCAAAACAACTATCCAGGTATCAAAGCTGA
GGAATGGGGAACTTTCCTTCACTGCAAAAACCAGATTTTC
ACAGATTTTAATGAAATTCGGAAAGAGATCGAGGAGGAAA
CCGATCGCAGTACCAATAATAAGGGCATCAGTAAAGAGCC
CATTTACCTGAAGATCTATTCCCCGAATGTACTCAGCCTG
ACGCTGGTGGACTTGCCTGGCATCACCAAGGTCCCTGTTG
GAGACCAGCCTGAAGACATCGAGATTCAAGTCCAAGAGAT
GATCCTGTCCTACATCTCCAACCCAAACTCCCTCATCCTG
TGCGTGTCTCCTGCAAACTCTGACCTCGCCACATCAGACG
CCCTAAAACTGGCACGAGAGGTGGACGCAGATGGTCGCAG
GACGCTTCTGGTTGTGAGTAAGCTGGATCTGATGGACGCG
GGGACAGATGCTCTGGAGGTGCTGCTGGGACGGGTCATAC
CAGTCAGACTGGGCATTATTGGTGTGGTTAACAGGAGTCA
ACATGACTTGAACACTCAGAAGAGTCTCTCTGACTCCTGT
AGGGATGAGCAGGCGTTTCTGCAGCGGCATTACCCGTCAT
TAGCTTCTCGCTGCGGCTCCCGCTATCTGGCTCGCACCCT
GAGCCGCCTGCTCATGCATCACATCAGAGACTGCCTGCCG
GAGCTCAAGACCCGTGTCACGGTGCTCACGGCCCAGTATC
AGTCCAGACTCAACAGCTACGGGCAGCCGGTGGAGGACCA
CAGCGCCACCTTGCTGCAGATCGTCACCAAGTTCGCCACC
GACTACTGCAGCACAATCGAAGGCACGGCCAGACACATCC
AGACCTCTGAACTGTGCGGAGGAGCTCGCATGTGTTACAT
TTTCCACGAGACGTTTGGAAGAACCCTGCAGTCCATTGAC
CCACTTGGAGGACTCACTGAGCTCGATATTCTCACAGCTA
TTCGAAATGCTACGGGTCCTCGGCCGGCGCTGTTCGTTCC
AGAGGTCAGTTTTGAGCTGCTGGTGAAGAAGCAGATCAAG
AGACTGGAGGAGCCCAGTTTGCGATGCGTGGAGCTCGTAC
ATGAAGAGCTTCAGAGGATCATCCAGCACTGCTCGTCCTA
CAGCACACAGGAGCTGTTGAGGTTTCCCAAACTGCACGAT
TCAATAGTGGAGGTGGTCACCGGCTTACTCAGGAAACGCC
TGCCTATTACTAATGAGATGGTTCATAATCTGGTTGCGAT
CGAGTTGGCCTATATAAACACCAAACATCCAGACTTCACT
GACGCTGCCCAAGTGTCTGCATCCGTCAACAGCCAGCAGG
CGGAGGCCGGGGATGGAGGGAAGCGCTGGAAGAATGAGAA
GATGCCGTCTGAGGAGAAAGGCCCAATGCCTGGATTTGGA
AGCCCCAGCAAAGCCATCAACCTGTTGGACACGGCCGTGC
CAGTATCGCGCAAACTGAGCTCTCGAGAGCAGCGGGACTG
TGAGGTGATCCAGAGACTCATCAAATGCTACTTTCTGATC
GTGCGCAAGAGCATTCAGGACAGTGTGCCAAAGACAGTGA
TGCATTTCCTGGTGAATTTCGTGAAGGAGCATCTGCAGAG
TGAGCTGGTGGGTCAGCTTTACAAACAGCCTCTGCTGCAG
GAGTTGCTCATCGAGTCTCAGGAAACAGCACAGCAGCGCA
CTGAGGTCGCACACATGCTGGAGGCCCTCAAGAAAGCCAG
TAACATTATCTCAGAGATCCGCGAGACTCATCTTTGGTAG
CCAAACGTTCTCATCGAACAGTCTGTCCAGGAAAGTGTTT
ACATGTTTGTTTGTGCTGTGTGTGTGCGATTGTGTATGTG
ACGAGCGTGTATGTAAATGTGAAGAAACACAATGCCTCCG
CCAGCATGAACACTCAACAAACTCTGTACAGTTTTCCAGA
AGCTCCTTATTTCTACTGCATATGCACTGATTCAATAACT
CTGAGGTCAAACGAGTGTGTGTTTGTGTATGTTTGTAATC
AGATATAGTGAACATATCAACACCATATTGTGTTATTCAT
CGTCATAAACCTTATATAATGACGAATAATCGATCATTTA
GTGTTATAATAATTGAAAAATGTCCTGAATGGTACACTAT
AAAAGACATTAGTTGAATTTACTTCAAAAAGTGAGTAAAC
TCGTTGCAATAAAATCAATCATAAACTGTGTGCATAATTA
TAAGAAATAAAGTCAACTTGACAGCCATTTTGTGCCAGAC
CGCACACGACACACCAGGTG

si:dkey-32e23.4 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-32e23.4-202 3060
ncRNA si:dkey-32e23.4-002 (1)    Ensembl 515
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-32e23.4-202 Contained in:
[BAC] DKEY-32E23 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036129 (1),  Ensembl_Trans:ENSDART00000142061 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EE322953 (1) 849 nt
GenBank:DR724335 (1) 799 nt
GenBank:DT056038 (1) 714 nt
GenBank:EB950835 (1) 667 nt
GenBank:AL927909 (1) 536 nt
GenBank:EB903932 (1) 455 nt
GenBank:EB967791 (1) 369 nt
CITATIONS (2)