ZFIN ID: ZDB-TSCRIPT-090929-16637
Transcript Name: si:dkey-57a22.13-203
Previous Name: si:dkey-57a22.13-003

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: mRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036097 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036097|OTTDARG00000026178|ZDB-GENE-081104-425 si:dkey-57a22.13|OTTDARP00000028964 DKEY-57A22.13-003 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 882 bp
GACTGTTTCTCTTGTTTACCACTTCTGAGACTCACATCAA
AATGAGTAAGATTATCTTTTATGAGGAGAAAAACTTCCAG
GGTTGCTCCTTTAAATGTGACTGCCCAGACATGAAACCTC
ATTTCATCCGATGCAACTCTGCCAGGGTGGAGATCGGCTG
CTGGGTCTTGTATGAAAGGCCCAACTACTCTGGACACCAG
TATGTGCTAACCAAAGAAGAATATCCTGAGTATCACTCTT
GGATGGGCTACAATGACACTATTTGCTCATGCCGTAATTT
GTTCTGTGAGTGATATGCCTGTAAAGCTTTCATAATATAT
TTAGTCAGTTCTTGTATATGATTCGTTGCCTTTAATATTT
TGTTCCATCTTTGATGTTTATTGTTCTGCCACAAATAATT
TTGTACGCATGTTTAAACATTCAAACTGTATGTTTGGGTG
TTCAAACCTGGTTTTGAAGGGCCGCTGTGAGTTTAGCTCC
AGCCTTATTAAACACACTAAGTTAATTAGAGTCTCCAAGT
TCATTAGAAATTACCAGGCAGAGATGTGTTTGAGACAAAG
TCTGTGAAACATCAGGCCTCCAGCACCAGGACTGTACACC
CTATACTTTACAAACTTTGAATTTAAAGCTCAACTGTTTT
TCAGAATAGTGAAGGACCTCACTGAATCCATATATACGAT
CGGCCAGATTTCCAAGGTCAGATGATGGAATTCAATGATG
ACTGCGAATCCATTCATCAAAGTTTCCATTGTCACAGCAT
TCACTCTTGCAATGTCATGGAGGGCCACTGGACCTTCTAT
GAACACTCTGGCTTTCTAGGTTGTCAGTATTTCATGGCTC
CTGGTGAATATCACAAGTTTGTAAACTGGGGTGCCACATG
TG

si:dkey-57a22.13 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-57a22.13-201 (1)    Ensembl 619
si:dkey-57a22.13-203 882
ncRNA si:dkey-57a22.13-002 (1)    Ensembl 671
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.13-203 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036097 (1),  Ensembl_Trans:ENSDART00000146829 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH455338 (1) 912 nt
CITATIONS (2)