ZFIN ID: ZDB-TSCRIPT-090929-16636
Transcript Name: si:dkey-57a22.13-002
Previous Name:

Add new Alias

Alias
Attribution

Attributions for Alias: {{control.newAlias}}

{{pub.zdbID}}

Delete Alias:

(Including Attributions)
Transcript Type: ncRNA
Annotation Status:
Strain: TU
Non Reference Strains:
Associated with Genes:
SEQUENCE
OTTDART00000036096 (1) [ Show ] (double-click sequence to select) [Download]
Select Analysis Tool
>tpe|OTTDART00000036096|OTTDARG00000026178|ZDB-GENE-081104-425 si:dkey-57a22.13|no_translation DKEY-57A22.13-002 LG_ CR536604.6 Danio rerio protein_coding NOVEL, 671 bp
GACATTTATAAAGCAGACCTCCTGCCCTAATTTGTTTGAC
TGTTTCTCTTGTTTACCACTTCTGAGACTCACATCAAAAT
GAGTAAGTGACATCGCTCACTCACAGATTATCTTTTATGA
GGAGAAAAACTTCCAGGGTTGCTCCTTTAAATGTGACTGC
CCAGACATGAAACCTCATTTCATCCGATGCAACTCTGCCA
GGGTGGAGATCGGCTGCTGGGTCTTGTATGAAAGGCCCAA
CTACTCTGGACACCAGTATGTGCTAACCAAAGAAGAATAT
CCTGAGTATCACTCTTGGATGGGCTACAATGACACTATTT
GCTCATGCCGTAATTTGTTCTAATAGTGAAGGACCTCACT
GAATCCATATATACGATCGGCCAGATTTCCAAGGTCAGAT
GATGGAATTCAATGATGACTGCGAATCCATTCATCAAAGT
TTCCATTGTCACAGCATTCACTCTTGCAATGTCATGGAGG
GCCACTGGACCTTCTATGAACACTCTGGCTTTCTAGGTTG
TCAGTATTTCATGGCTCCTGGTGAATATCACAAGTTTGTA
AACTGGGGTGCCACATGTGCCACAATTGGCTCCTTCCGCA
GAATCACTGATTTTGAAAGCTCCAATAACTGTGCCTTTTC
AGCATTGATTTGTCATTAAATTGTCACAAAA

si:dkey-57a22.13 TRANSCRIPTS
Type Name Length (nt) Analysis
mRNA si:dkey-57a22.13-201 (1)    Ensembl 619
si:dkey-57a22.13-203 (1)    Ensembl 882
ncRNA si:dkey-57a22.13-002 671
SEGMENT (CLONE AND PROBE) RELATIONSHIPS
si:dkey-57a22.13-002 Contained in:
[BAC] DKEY-57A22 (1) (order this)

Genome Resources: Vega_Trans:OTTDART00000036096 (1),  Ensembl_Trans:ENSDART00000138712 (1)
PROTEIN PRODUCTS No links to external site
ZEBRAFISH SUPPORTING SEQUENCES
Type Accession # Length (nt/aa) Analysis
RNA GenBank:EH443769 (1) 684 nt
CITATIONS (2)